Last data update: 24 January 2024 16:39 CET
Plasmid name: pUHD-2FKBP-link-mCASP-8 (LMBP 4618)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner non-core plasmid |
| Depositor's sequence: | p4618.gb |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Mouse cysteinyl aspartate specific proteinase 8 cDNA (caspase-8, CASP-8, Casp8, MCH5, MACH, FLICE) Human FK506-binding protein prolyl isomerase 1A cDNA (FKBP1A, FKBP-12, FKBP12C, PKC12, PPIASE, GeneID 2280) Rous sarcoma virus (RSV) tyrosine kinase gene (v-src); myristoylation-targeting sequence, N-terminal GSGGGS linker; N-terminal Influenza HA epitope encoding the haemagglutinin tagging peptide; C-terminal |
| Promoter: | Human cytomegalovirus immediate early promoter (CMV-IE); minimal promoter with tet operator (CMVT) |
| Ribosome binding site: |
- |
| Terminator: | Simian virus 40 polyadenylation signal (SV40 polyA) |
| Selection marker: | Ampicillin (amp) |
| Replicon: | Escherichia coli plasmid pMB1 origin |
| Host range: | Escherichia coli; preferably recombination-deficient strains Mammalian cells; use strains expressing a tetracycline-controlled transcriptional activator |
| Parental clone: | pUHD10-3; pCMF2E-link-mCASP-8 |
| Further information: | The plasmid was constructed by inserting the 2857 bp EcoRI fragment of pCMF2E-link-mCASP-8, containing the mouse cysteinyl aspartate specific proteinase 8 coding sequence (caspase-8, mCASP-8, MACH, FLICE) fused to the N-terminal myristoylation-targeting sequence of the Rous sarcoma virus (RSV) tyrosine kinase gene (v-src), the N-terminal tandem repeat of the human FK506-binding protein 1A cDNA, the N-terminal GSGGGS linker and the C-terminal HA epitope in the EcoRI opened pUHD10-3. The plasmid is designed for tetracycline controlled expression of the fusion protein under control of the hCMVT promoter in Tet-Off and Tet-On gene expression systems and cell lines. The hCMVT promoter is composed of a minimal hCMV-IE promoter preceded by the Tet-responsive element (TRE), which consists of seven copies of the 42 bp tetracycline operator O2 of E. coli Tn10 (tetO), which contain each a 19 bp inverted repeat sequence. The hCMVT promoter is responsive to the tTA and rtTA regulatory proteins in the Tet-Off and Tet-On systems, respectively. tTA (tet-controlled transcriptional activator) is a fusion of the wild-type Tet repressor (TetR) to the VP16 activation domain (AD) of Herpes simplex. tTA binds the tetO sequence and thereby activates transcription in the absence of tetracycline. Reverse tTA (rtTA) is a fusion of rTetR, which differs from the wild-type TetR by four amino acid exchanges, to VPad and activates transcription in the presence of doxycyclin (a tetracycline derivative). hFKBP1A is a member of the immunophilin protein family, which plays a role in immunoregulation and basic cellular processes involving protein folding and trafficking. This encoded protein is a cis-trans prolyl isomerase that binds the immunosuppressants FK506 and rapamycin. The fusion protein can be dimerized upon AP1510 (synthetic analogue of FK1012 ligand) administration. The v-src myristoylation-targeting sequence directs the fusion protein to cellular membranes. The nucleotide sequence of the mCASP-8 cDNA corresponds with the EMBL Nucleotide Sequence Database accession number AJ007749.1. Other name of the plasmid is pUHD-2FKBP-link-mcaspase-8. |
| EMBL Accession number: | AJ007749.1, view at EMBL, GenBank, DDBJ |
| Latest sequence update: | 02/02/2004 |
| Sequence detail: | Nucleotide sequence of the hCMVT promoter:
------------------------------- hCMVT promoter
----------- Tet-responsive element ---------->
5' (GAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTC)x7
--------- ---------
inverted repeat
hCMVT promoter -------------------------------------------------------->
GAGCTCGGTACCCGGGTCGAGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCTCGTTTAGTGAACCG
SacI SmaI ^ -------
KpnI StuI
------------ mRNA ----------->
TCAGATCGCCTGGAGACGCCATCCACGCT ... 3'
^: mutated nucleotide at position -31.
Nucleotide sequence of the fusion gene:
------- v-src myristoylation-targeting sequence ------>
5' ... GCGGCCCCGAATTCGCGCGT.ATG.GGG.AGT.AGC.AAG.AGC.AAG.CCT.AAG.GAC.CCC.AGC.CAG.CGC.TCT
EcoRI Met Gly Ser Ser Lys Ser Lys Pro Lys Asp Pro Ser Gln Arg Ser
*** XbaI
SalI|XhoI
------------- hFKBP1A ------------> | ------------- hFKBP1A ------------>
AGA.GGA.GTG.CAG.GTG ... CTA.AAA.CTG.GAA.GTC|GAG.GGC.GTG.CAG.GTG ... CTA.AAA.CTG.GAA
Arg Gly Val Gln Val Leu Lys Leu Glu Val|Glu Gly Val Gln Val Leu Lys Leu Glu
------- linker -------> --------------------- mCASP-8 -------------------->
ACT.AGT.GGG.TCT.GGA.GGC.GGA.TCC.ATG.GAT.TTC.CAG.AGT.TGT ... AAG.CTC.TTC.TTC.CCT.CCC
Thr Ser Gly Ser Gly Gly Gly Ser Met Asp Phe Gln Ser Cys Lys Leu Phe Phe Pro Pro
SpeI G S G G G S
BamHI
NcoI
----------- HA epitope ----------->
ACT.AGT.TAT.CCG.TAC.GAC.GTA.CCA.GAC.TAC.GCA.TAA.GAAAAGTGAGGATCCTGAGAA ... 3'
Thr Ser Tyr Pro Tyr Asp Val Pro Asp Tyr Ala +++ BamHI
SpeI
***: Start codon.
+++: Termination codon.
Punctuation indicates reading frame. |
| Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Prof. Dr P. Vandenabeele(1) (2). It was constructed by G. Van Loo(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | - |
| Related plasmid reference: | Gossen et al., Proc. Natl. Acad. Sci. U.S.A. 89 (1992), 5547-5551 [PMID: 1319065] Van de Craen et al., J. Mol. Biol. 284 (1998), 1017-1026 [PMID: 9837723] |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 MC1061 |
| Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
| Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Cultivation remark: | - |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pUHD-2FKBP-link-mCASP-8 (LMBP 4618) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr P. Vandenabeele . |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.