Last data update: 24 January 2024 16:39 CET
Plasmid name: pUHDE6Hy3f2ANGKDEL (LMBP 3561)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner non-core plasmid |
| Depositor's sequence: | p3561.gb |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Mouse anti-hPLAP monoclonal antibody E6(Hy3,κ) cDNA; truncated mouse::human chimeric heavy chain of the F(ab')2 fragment E6(Hy3,κ)F2 (E6Hy3f2) Human angiogenin gene (hANG); mature sequence extended with the C-terminal KDEL endoplasmic reticulum retention signal (hANGKDEL) |
| Promoter: | Human cytomegalovirus immediate early promoter (CMV-IE); minimal promoter with tet operator (CMVT) |
| Ribosome binding site: |
- |
| Terminator: | Simian virus 40 polyadenylation signal (SV40 polyA) |
| Selection marker: | Ampicillin (amp) |
| Replicon: | Escherichia coli plasmid pMB1 origin |
| Host range: | Escherichia coli; preferably recombination-deficient strains Mammalian cells; use strains expressing a tetracycline-controlled transcriptional activator |
| Parental clone: | pUHDE6Hy3f2ETA; pUHDE6Hy3f2ANG |
| Further information: | The plasmid was constructed by inserting the mature human angiogenin gene as a MluI-EcoRI fragment into the MluI-EcoRI opened pUHDE6Hy3f2ETA plasmid. This fragment was derived from pUHDE6Hy3f2ANG via PCR. pUHDE6Hy3f2ANGKDEL is an expression vector for the heavy chain of a mouse::human immunotoxin, extended with 4 amino acids Lys-Asp-Glu-Leu (KDEL), in mammalian cells. This plasmid has to be used in combination with an E6L (light chain of the mouse monoclonal antibody E6(IgG2b,κ)) expression vector (e.g. pCAGGSE6L) to produce a hPLAP (human placental alkaline phosphatase) -specific mouse::human chimeric immunotoxin. The KDEL signal at the carboxy-terminus of the heavy chain mouse::human immunotoxin was engineered to enhance cytotoxicity in the target (= tumor) cell. Unfortunately, this KDEL-signal will probably result in the retention of the immunotoxin in the endoplasmic reticulum of the producing host cell. To avoid this retention, a derivative was constructed containing a masked KDEL-signal: pUHDE6Hy3f2ANGKDELKR (SN: 3562). The hCMVT promoter is composed of a minimal hCMV-IE promoter preceded by the Tet-responsive element (TRE), which consists of seven copies of the 42 bp tetracycline operator O2 of E. coli Tn10 (tetO), which contain each a 19 bp inverted repeat sequence. Cotransfection with pUHD15-1, pUHG17-1 or pUHD172-1neo is necessary for tetracycline controlled gene expression in mammalian cells. The fusion between the E6Hy3f2 sequence and the mature human angiogenin sequence is characterized by a Asp-(Ala-Leu)2 linker which is acid protease (cathepsin)-sensitive. The nucleotide sequence of the mature human angiogenin gene corresponds with the EMBL Nucleotide Sequence Database accession number M11567.1. |
| EMBL Accession number: | M11567.1, view at EMBL, GenBank, DDBJ |
| Latest sequence update: | 25/11/1996 |
| Sequence detail: | Primers used to amplify hANG cds:
Forward: 5' CGCGGACGCGTTAGCGCTCGCCCAGGATAACTCCAGGTACACACACTTCCT
Reverse: 5' CACAGCTCTAGATTACGGACGACGGAAAATTGACTG
Nucleotide sequence of the hCMVT promoter:
------------------------------- hCMVT promoter
----------- Tet-responsive element ---------->
5' (GAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTC)x7
--------- ---------
inverted repeat
hCMVT promoter -------------------------------------------------------->
GAGCTCGGTACCCGGGTCGAGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCTCGTTTAGTGAACCG
SacI SmaI ^ -------
KpnI StuI
------------ mRNA ----------->
TCAGATCGCCTGGAGACGCCATCCACGCT ... 3'
^: mutated nucleotide at position -31.
Nucleotide sequence at the E6Hy3f2-ANG fusion:
> hinge|--> part CH2 + linker
5' TGC.CCA.GCA.CCT.GAA.CTC.TTG. ... .CCT.GAC.TTA.GTT.GAC.GCG.
Ser Pro Ala Pro Glu Leu Leu Pro Asp Leu Val Asp Ala
MluI
|--> mature human angiogenin gene
TTA.GCG.CTC.GCC.CAG.GAT.AAC.TCC. 3'
Leu Ala Leu Ala Gln Asp Asn Ser
Punctuation indicates reading frame.
Nucleotide sequence at the end of the human angiogenin gene:
R R P K D E L
Arg Arg Pro Lys Asp Glu Leu
5' CGT.CGT.CCG.AAG.GAC.GAG.CTC.TAA GAATTCTTGAA 3'
SacI * EcoRI
*: Termination codon.
Punctuation indicates reading frame.
Mutated sequence at the end of the leader signal of the E6Hy3f2 gene on this plasmid:
--> Leader |--> Variable region
Val Gln Ser Gln Val Gln
Wild type E6Hy3f2: 5' GTC.CAA.TCC.CAG.GTT.CAG. 3'
--> Leader |--> Variable region
Val Arg Tyr Gln Val Gln
Mutated E6Hy3f2: 5' GTC.CGG.TAC.CAG.GTT.CAG. 3'
^^ ^
KpnI
^: Mutated nucleotide.
Punctuation indicates reading frame. |
| Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Prof. Dr N. Callewaert(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | - |
| Related plasmid reference: | Kurachi et al., Biochemistry 24 (1985), 5494-5499 [PMID: 2866795] |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 MC1061 |
| Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
| Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pUHDE6Hy3f2ANGKDEL (LMBP 3561) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr N. Callewaert . |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.