Last data update: 24 January 2024 16:39 CET
Plasmid name: pUHGIRES-lacZ (LMBP 3592)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner non-core plasmid |
| Depositor's sequence: | p3592.gb |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Escherichia coli lac Z gene (lacZ) |
| Promoter: | Human cytomegalovirus immediate early promoter (CMV-IE); minimal promoter with tet operator (CMVT) |
| Ribosome binding site: |
Internal ribosome entry site (IRES) of the encephalomyocarditis virus (EMCV) polyprotein gene |
| Terminator: | Rabbit β-globin polyadenylation signal (β-globin polyA) |
| Selection marker: | Ampicillin (amp) |
| Replicon: | Escherichia coli plasmid pMB1 origin |
| Host range: | Escherichia coli; preferably recombination-deficient strains Mammalian cells; use strains expressing a tetracycline-controlled transcriptional activator |
| Parental clone: | pIRES-lacZ; pUHG16-3 |
| Further information: | The plasmid was constructed as follows: the SacII-EcoRV fragment of pIRES-lacZ containing the IRES sequence and part of lacZ was ligated in the SacII-EcoRV opened pUHG16-3 vector. The IRES-lacZ insert enables the creation of bicistronic or polycistronic transcripts in mammalian cells, using the lacZ gene as a reporter gene. The hCMVT promoter is composed of a minimal hCMV-IE promoter preceded by the Tet-responsive element (TRE), which consists of seven copies of the 42 bp tetracycline operator O2 of E. coli Tn10 (tetO), which contain each a 19 bp inverted repeat sequence. pUHGIRES-lacZ is, when used in combination with pUHD15-1, pUHG17-1 or pUHD172-1neo, a control vector for tetracycline controlled gene expression in mammalian cells. The IRES (internal ribosome entry site) is derived from the 5' untranslated region of the encephalomyocarditis virus polyprotein gene. The nucleotide sequence of this 5' UTR corresponds with the EMBL Nucleotide Sequence Database accession number M81861.1. Other name of the plasmid is pUHG16-3I. |
| EMBL Accession number: | M81861.1, view at EMBL, GenBank, DDBJ |
| Latest sequence update: | 05/07/1999 |
| Sequence detail: | Nucleotide sequence of the hCMVT promoter:
5' ( TCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAG )7 TCGAGCTCGGTACCCGGG
XhoI --------- --------- SacI SmaI
inverted repeat KpnI
-53 -31 -1
TCGAGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCTCGTTTAGTGAACCG… 3'
* -------
StuI SD
*: Mutated nucleotide.
SD: Shine Dalgarno |
| Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Prof. Dr R. Beyaert(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | - |
| Related plasmid reference: | Gossen et al., Proc. Natl. Acad. Sci. U.S.A. 89 (1992), 5547-5551 [PMID: 1319065] |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 MC1061 |
| Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
| Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Other culture collection numbers: | - |
| Related website: | http://www.iresite.org/IRESite_web.php |
Refer in your Materials and Methods: |
pUHGIRES-lacZ (LMBP 3592) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr R. Beyaert . |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.