Last data update: 24 January 2024 16:39 CET
Plasmid name: pVLIVHAs (LMBP 3457)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner non-core plasmid |
| Depositor's sequence: | pvlivhas.gb |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Influenza A virus (A/Victoria/3/1975(H3N2)) haemagglutinin cDNA (HA, IVHA); N-terminal anchor free |
| Promoter: | Escherichia coli lac operon promoter Autographa californica nuclear polyhedrosis virus (AcNPV) polyhedrin promoter (PH) |
| Ribosome binding site: |
- |
| Terminator: | - |
| Selection marker: | Ampicillin (amp) |
| Replicon: | Escherichia coli plasmid pMB1 origin |
| Host range: | Escherichia coli Insect cells |
| Parental clone: | pUCIVHAs; pVL1392 |
| Further information: | This plasmid was constructed by cloning the BamHI-PstI and PstI fragments of pUCIVHAs (containing the gene encoding a secreted form of the A/Victoria/3/75 influenza haemagglutinin protein) in the BamHI and PstI sites of the polylinker behind the late polyhedrin promoter of pVL1392. Upon cotransfection with baculogold DNA (PharMingen) a recombinant baculovirus can be obtained, to express anchor-free HA in insect cells. When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide. |
| EMBL Accession number: | - |
| Latest sequence update: | 20/05/1996 |
| Sequence detail: | Nucleotide sequence at the C-terminus of the IVHAs gene:
186
...TAC.AAA.GAC.TGG.ATC.TAGTTAACTAAGGATCCACTCCT|GGGTAC...
-----------------------------|<-- pUC18
Tyr Lys Asp Trp Ile @ @ @
HpaI BamHI
linker : 5' GATCTAGTTAACTAAGGATCCACTCCT 3'
3' ATCAATTGATTCCTAGGTGAGGA 5'
@ : termination codon |
| Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: AgeI, HindIII, SpeI and XhoI. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by P. Vanlandschoot(1) (2) and Prof. Dr W. Min Jou(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | PhD thesis Peter Vanlandschoot |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 DH5α |
| Host reference: | Focus 8 (1986), 9 |
| Related host reference: | Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660] Rodriguez-Quinones et al., Focus 15 (1993), 110-112 Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791] [DOI: 10.1016/s0022-2836(83)80284-8] Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187] Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pVLIVHAs (LMBP 3457) is available at BCCM/GeneCorner. This plasmid was deposited by P. Vanlandschoot and Prof. Dr W. Min Jou and was published in Peter Vanlandschoot, . |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.