Last data update: 24 January 2024 16:39 CET
Plasmid name: pENTR221-hHOIL1-R165[P2A] (LMBP 9157)
New search | Print data sheet |
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner non-core plasmid |
Depositor's sequence: | not available |
Sequence analysis results Genecorner: |
- |
Cloned DNA: |
Human RANBP2-type and C3HC4-type zinc finger containing 1 cDNA (RBCK1, HOIL1, RBCK2, RNF54, UBCE7IP3, XAP4, ZRANB4, GeneID 10616); mutated sequence Porcine teschovirus-1 2A peptide (P2A) |
Promoter: | Phage T7 gene 10 promoter (T7g10) |
Ribosome binding site: |
- |
Terminator: | Escherichia coli rrnB operon T2 terminator Escherichia coli rrnB operon T1 terminator |
Selection marker: | Neomycin (neo; kanamycin (kan)) |
Replicon: | Escherichia coli plasmid pMB1 origin |
Host range: | Escherichia coli |
Parental clone: | pDONR221; pCDNA3zeo-HOIL |
Further information: | The plasmid was contructed by fusion PCR, amplifying the first and second part of the human RBCK1 coding sequence from pCDNA3zeo-HOIL and fusing a P2A sequence between them, replacing the R165 codon. The resulting coding sequence was cloned into pDONR221 via Gateway BP recombination. P2A is a non-enzymatic autoprocessing peptide for polycistronic expression, and replaces the MALT1 cleavage site of human RBCK1 in this plasmid. Upon transfer of the human RBCK1 coding sequence to an expression vector, a constituitively cleaved RBCK1 protein will be expressed. The nucleotide sequence of the wild type human RBCK1 coding sequence corresponds with Genbank accession number NG_033233.1. Other name of the plasmid is pENTR221-HOIL-1L-R165[P2A]. |
EMBL Accession number: | AF420371.1, view at EMBL, GenBank, DDBJ |
Latest sequence update: | 20/04/2020 |
Sequence detail: | Primers used to amplify the human RBCK1 coding sequence: Forward: attB1-ccATGGACGAGAAGACCAAGAAAG Reverse: attB2-GTGGCAGTTCTGACAGCTTG Fusion primers for the P2A fusion: Right fragment: aggctggagacgtggaggagaaccctggacctggccctctggagccaggc Left fragment: cttcagcaggctgaagttagtagctccgcttcccggctgcagcgtgaggtc P2A: ggaagcggagctactaacttcagcctgctgaagcaggctggagacgtggaggagaaccctggacct P2Arc: aggtccagggttctcctccacgtctccagcctgcttcagcaggctgaagttagtagctccgcttcc |
Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | This plasmid was deposited by Dr J. Staal(1) (2) and Prof. Dr R. Beyaert(1) (2). (1) UGent-VIB Center for Inflammation Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
Plasmid reference: | - |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 DH5α |
Host reference: | Focus 8 (1986), 9 |
Related host reference: | Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660] Rodriguez-Quinones et al., Focus 15 (1993), 110-112 Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791] [DOI: 10.1016/s0022-2836(83)80284-8] Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187] Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051] |
Cultivation medium: | LB-Lennox + kanamycin (50 μg/ml) |
Cultivation temperature: | 37°C |
Biosafety level: | L1 |
Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pENTR221-hHOIL1-R165[P2A] (LMBP 9157) is available at BCCM/GeneCorner. This plasmid was deposited by Dr J. Staal and Prof. Dr R. Beyaert . |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.