GREAT AT SMALL THINGS

0

GeneCorner plasmid details

Last data update: 24 January 2024 16:39 CET

Plasmid name: pENTR221-hHOIL1-R165[P2A] (LMBP 9157)

Add to cart

New search Print data sheet
Price category: Cat. 1 (cf. price list)
Status: GeneCorner non-core plasmid
Depositor's sequence: not available
Sequence
analysis results
Genecorner:

-

Cloned DNA: Human RANBP2-type and C3HC4-type zinc finger containing 1 cDNA (RBCK1, HOIL1, RBCK2, RNF54, UBCE7IP3, XAP4, ZRANB4, GeneID 10616); mutated sequence
Porcine teschovirus-1 2A peptide (P2A)
Promoter: Phage T7 gene 10 promoter (T7g10)
Ribosome
binding site:
-
Terminator: Escherichia coli rrnB operon T2 terminator
Escherichia coli rrnB operon T1 terminator
Selection marker: Neomycin (neo; kanamycin (kan))
Replicon: Escherichia coli plasmid pMB1 origin
Host range: Escherichia coli
Parental clone: pDONR221; pCDNA3zeo-HOIL
Further information: The plasmid was contructed by fusion PCR, amplifying the first and second part of the human RBCK1 coding sequence from pCDNA3zeo-HOIL and fusing a P2A sequence between them, replacing the R165 codon. The resulting coding sequence was cloned into pDONR221 via Gateway BP recombination.
P2A is a non-enzymatic autoprocessing peptide for polycistronic expression, and replaces the MALT1 cleavage site of human RBCK1 in this plasmid. Upon transfer of the human RBCK1 coding sequence to an expression vector, a constituitively cleaved RBCK1 protein will be expressed.
The nucleotide sequence of the wild type human RBCK1 coding sequence corresponds with Genbank accession number NG_033233.1.
Other name of the plasmid is pENTR221-HOIL-1L-R165[P2A].
EMBL Accession number: AF420371.1, view at EMBL, GenBank, DDBJ
Latest sequence update: 20/04/2020
Sequence detail:
Primers used to amplify the human RBCK1 coding sequence:

Forward: attB1-ccATGGACGAGAAGACCAAGAAAG
Reverse: attB2-GTGGCAGTTCTGACAGCTTG

Fusion primers for the P2A fusion:
Right fragment: aggctggagacgtggaggagaaccctggacctggccctctggagccaggc
Left fragment:  cttcagcaggctgaagttagtagctccgcttcccggctgcagcgtgaggtc

P2A: ggaagcggagctactaacttcagcctgctgaagcaggctggagacgtggaggagaaccctggacct
P2Arc: aggtccagggttctcctccacgtctccagcctgcttcagcaggctgaagttagtagctccgcttcc
Authenticity test: The plasmid still needs to be subjected to the authenticity test.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Dr J. Staal(1) (2) and Prof. Dr R. Beyaert(1) (2).
(1) UGent-VIB Center for Inflammation Research, VIB, Ghent, Belgium
(2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium
Plasmid reference: -
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 DH5α
Host reference: Focus 8 (1986), 9
Related host reference: Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660]
Rodriguez-Quinones et al., Focus 15 (1993), 110-112
Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791] [DOI: 10.1016/s0022-2836(83)80284-8]
Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187]
Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051]
Cultivation medium: LB-Lennox + kanamycin (50 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Other culture collection numbers: -

Refer in your Materials and Methods:

pENTR221-hHOIL1-R165[P2A] (LMBP 9157) is available at BCCM/GeneCorner. This plasmid was deposited by Dr J. Staal and Prof. Dr R. Beyaert .

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search