Last data update: 24 January 2024 16:39 CET
Plasmid name: pSV-Sport-di-RF-UNR(261-447) (LMBP 5213)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner core plasmid |
| GeneCorner sequence: |
p5213.gb
(View with Genome Compiler) p5213.txt p5213.pdf |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Photinus pyralis (firefly) luciferase gene (LUC); mutated coding region (LUCm; luc(+)) Renilla reniformis luciferase gene (rLUC) |
| Promoter: | Phage SP6 promoter Phage T7 gene 10 promoter (T7g10) Escherichia coli lac operon promoter; mutant (lacUV5) Simian virus 40 early promoter (SV40 early) |
| Ribosome binding site: |
Internal ribosome entry site (IRES) of the human upstream of N-ras (UNR, CSDE1) isoform 1; deletion mutant (fragment 261-447) |
| Terminator: | Simian virus 40 polyadenylation signal (SV40 polyA) |
| Selection marker: | Ampicillin (amp) |
| Replicon: | Escherichia coli plasmid pMB1 origin Simian virus 40 bidirectional origin (SV40) |
| Host range: | Escherichia coli Mammalian cells; SV40 permissive cells |
| Parental clone: | pSV-Sport-Rluc; pUC19-UNR(261-447)-Fluc |
| Further information: | The plasmid was constructed by two successive three-point ligations as follows: (i) the PCR amplified UNR(261-447) fragment was digested with XbaI-NcoI and cloned together with the firefly luciferase coding sequence, obtained as an NcoI-HindIII fragment from pSV-Sport-Fluc, in the XbaI-HindIII linearized vector pUC19; (ii) the UNR(261-447)-Fluc insert was then recovered as an XbaI fragment and cloned in the XbaI linearized pSV-Sport-Rluc. pSV-Sport-di-RF-UNR(261-447) is a dicistronic expression vector with a deletion mutant (fragment 261-447) of the internal ribosome entry site (IRES) of the human upstream of N-ras (UNR) isoform 1 cloned in the intercistronic region between the upstream rLUC and downstream LUCm coding sequences. The IRES can drive translation of the downstream LUCm sequence independently of the 5'-cap structure bound to the 5'-end of the mRNA molecule. This mutant can not efficiently bind to endogenous Unr proteins and supports other findings that the Unr protein binds to the 5' half of the UNR IRES. When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide. The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT726971.1. The nucleotide sequence of the 5' UTR of the human UNR isoform 1 was obtained from Genbank (Accession number NM_001007553.1). Name mentioned in Schepens et al. (2007) is Di-pRF-UNR (261-447). Other name of the plasmid is Di-UNR (261-447). |
| EMBL Accession number: | NM_001007553.1, view at GenBank LT726971.1, view at EMBL, GenBank, DDBJ |
| Latest sequence update: | 03/01/2007 |
| Sequence detail: | The primers used in PCR to amplify the hUNR(261-447) fragment were:
forward: 5' CTAGTCTAGATGTTTTCTTCAGTGCTGTACTGTGAGATTGCC 3' Primer A *
XbaI
reverse: 5' CATGCCATGGCGCAGTGATACTCAAATATTGCACTTTCAGT 3' Primer B *
NcoI
* Schepens et al., EMBO J. 26 (2007), 158-169 |
| Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: HindIII, NcoI/XbaI and SspI. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Dr B. Schepens(1) (2) and Prof. Dr R. Beyaert(1) (2). It was constructed by Y. Bruynooghe(1) (2) . (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | Schepens et al., EMBO J. 26 (2007), 158-169 [PMID: 17159903] |
| Related plasmid reference: | Sherf et al., Promega Notes Magazine 49 (1994), 14-21 |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 MC1061 |
| Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
| Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Cultivation remark: | - |
| Other culture collection numbers: | - |
| Related website: | http://www.iresite.org/IRESite_web.php?page=view&entry_id=81 |
Refer in your Materials and Methods: |
pSV-Sport-di-RF-UNR(261-447) (LMBP 5213) is available at BCCM/GeneCorner. This plasmid was deposited by Dr B. Schepens and Prof. Dr R. Beyaert and was published in Schepens et al., 2007. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.