GREAT AT SMALL THINGS

4

GeneCorner plasmid details

Last data update: 24 January 2024 16:39 CET

Plasmid name: pSpCas9(BB)-2A-GFP-hCARD14-Ex14 (LMBP 10409)

Add to cart

New search Print data sheet
Price category: Cat. 1 (cf. price list)
Status: GeneCorner non-core plasmid
Depositor's sequence: p10409.gb
Sequence
analysis results
Genecorner:

-

Cloned DNA: Guide RNA targeting human caspase recruitment domain family member 14 gDNA (CARD14, BIMP2, CARMA2, PSORS2, GeneID 79092)
Streptococcus pyogenes CRISPR associated protein 9 cDNA (Cas9)
Thosea asigna virus 2A peptide (T2A)
SV40 large T-antigen nuclear localization signal (NLS); N-terminal
Aequorea victoria green fluorescent protein DNA (GFP); enhanced red-shifted variant (EGFP)
FLAG epitope tag; N-terminal
Promoter: Human U6 small nuclear RNA gene promoter
Chicken β-actin/rabbit β-globin hybrid promoter (AG)
Human cytomegalovirus immediate early promoter (CMV-IE); enhancer only
Ribosome
binding site:
-
Terminator: Bovine growth hormone polyadenylation signal (BGH polyA)
Selection marker: Ampicillin (amp)
Replicon: Bacteriophage M13 origin
Escherichia coli plasmid pMB1 origin
Host range: Escherichia coli
Mammalian cells
Parental clone: pSpCas9(BB)-2A-GFP (PX458)
Further information: The plasmid was constructed by cloning the guide RNA sequence for exon 14 of human CARD14 into the pSpCas9(BB)-2A-GFP (PX458) vector.
This vector allows for genomic modification in exon 14 of the human CARD14 coding sequence via the CRISPR-Cas9 system.
Other name of the plasmid is pX458-hCard14-Ex14.
EMBL Accession number: -
Latest sequence update: 08/08/2017
Sequence detail:
Oligo's used to create the guide RNA for exon 14 of human CARD14:

Forward: 5' CACCGGTGTAAGAGTTCACGCGGT
Reverse: 5' AAACACCGCGTGAACTCTTACACC
Authenticity test: The plasmid still needs to be subjected to the authenticity test.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Dr J. Staal(1) (2) and Prof. Dr R. Beyaert(1) (2).
(1) Center for Inflammation Research, VIB, Ghent, Belgium
(2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium
Plasmid reference: -
Related plasmid reference: Ran et al., Nat. Protoc. 8 (2013), 2281-2308 [PMID: 24157548] [DOI: 10.1038/nprot.2013.143]
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 DH5α
Host reference: Focus 8 (1986), 9
Related host reference: Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660]
Rodriguez-Quinones et al., Focus 15 (1993), 110-112
Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791] [DOI: 10.1016/s0022-2836(83)80284-8]
Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187]
Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051]
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Other culture collection numbers: -

Refer in your Materials and Methods:

pSpCas9(BB)-2A-GFP-hCARD14-Ex14 (LMBP 10409) is available at BCCM/GeneCorner. This plasmid was deposited by Dr J. Staal and Prof. Dr R. Beyaert .

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search