Last data update: 24 January 2024 16:39 CET
Plasmid name: pSpCas9(BB)-2A-GFP-hIKBKE-Ex2 (LMBP 10535)
New search | Print data sheet |
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner non-core plasmid |
Depositor's sequence: | p10535.gb |
Sequence analysis results Genecorner: |
- |
Cloned DNA: |
Guide RNA targeting human inhibitor of nuclear factor kappa B kinase subunit epsilon gDNA (IKBKE, IKK-i, IKKE, GeneID 9641) Streptococcus pyogenes CRISPR associated protein 9 cDNA (Cas9) Thosea asigna virus 2A peptide (T2A) SV40 large T-antigen nuclear localization signal (NLS); N-terminal Aequorea victoria green fluorescent protein DNA (GFP); enhanced red-shifted variant (EGFP) FLAG epitope tag; N-terminal |
Promoter: | Chicken β-actin/rabbit β-globin hybrid promoter (AG) Human cytomegalovirus immediate early promoter (CMV-IE); enhancer only Human U6 small nuclear RNA gene promoter |
Ribosome binding site: |
- |
Terminator: | Bovine growth hormone polyadenylation signal (BGH polyA) |
Selection marker: | Ampicillin (amp) |
Replicon: | Bacteriophage M13 origin Escherichia coli plasmid pMB1 origin |
Host range: | Escherichia coli Mammalian cells |
Parental clone: | pSpCas9(BB)-2A-GFP (PX458) |
Further information: | The plasmid was constructed by cloning the guide RNA sequence for exon 2 of human IKBKE into the pSpCas9(BB)-2A-GFP (PX458) vector. This vector allows for genomic modification in exon 2 of the human IKBKE coding sequence via the CRISPR-Cas9 system. Other name of the plasmid is pX458-hIKKepsilon-Ex2. |
EMBL Accession number: | - |
Latest sequence update: | 21/02/2018 |
Sequence detail: | Oligos used to create the hIKBKE guide RNA sequence for exon 2: Forward: CACCGAGAAGTTCGTCTCGGTCTA Reverse: AAACTAGACCGAGACGAACTTCTC |
Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | The plasmid was deposited by M. Lork(1)(2) and Prof. Dr R. Beyaert(1)(2). (1) Center for Inflammation Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
Plasmid reference: | - |
Related plasmid reference: | Ran et al., Nat. Protoc. 8 (2013), 2281-2308 [PMID: 24157548] [DOI: 10.1038/nprot.2013.143] |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 DH5α |
Host reference: | Focus 8 (1986), 9 |
Related host reference: | Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660] Rodriguez-Quinones et al., Focus 15 (1993), 110-112 Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791] [DOI: 10.1016/s0022-2836(83)80284-8] Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187] Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051] |
Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
Cultivation temperature: | 37°C |
Biosafety level: | L1 |
Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pSpCas9(BB)-2A-GFP-hIKBKE-Ex2 (LMBP 10535) is available at BCCM/GeneCorner. The plasmid was deposited by M. Lork and Prof. Dr R. Beyaert. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.