GREAT AT SMALL THINGS

2

GeneCorner plasmid details

Last data update: 24 January 2024 16:39 CET

Plasmid name: pX335-hTRAF2-CRISPR-4-Cas9(D10A) (LMBP 9421)

Add to cart

New search Print data sheet
Price category: Cat. 1 (cf. price list)
Status: GeneCorner non-core plasmid
Depositor's sequence: not available
Sequence
analysis results
Genecorner:

-

Cloned DNA: Guide RNA targeting human TNF receptor associated factor 2 gDNA (TRAF2, TRAP3, RNF117, GeneID 7186)
Streptococcus pyogenes CRISPR associated protein 9 cDNA (Cas9); mutated modified sequence
SV40 large T-antigen nuclear localization signal (NLS); N-terminal
Influenza HA epitope encoding the haemagglutinin tagging peptide; N-terminal
Promoter: Human U6 small nuclear RNA gene promoter
Human cytomegalovirus immediate early promoter (CMV-IE); enhancer only
Chicken β-actin promoter (ACTB)
Ribosome
binding site:
-
Terminator: Bovine growth hormone polyadenylation signal (BGH polyA)
Selection marker: Ampicillin (amp)
Replicon: Escherichia coli plasmid pMB1 origin
Phage f1 origin
Host range: Escherichia coli
Mammalian cells
Parental clone: pX335
Further information: The plasmid was constructed by cloning the synthetic human TRAF2 CRISPR gRNA fragment into the Bbs1 opened pX335 vector.
This CRISPR genome editing plasmid encodes the nickase Cas9 (D10A mutant) and targets exon 1 of the human TRAF2 coding sequence.
Other name of the plasmid is pX335 TRAF2 CRISPR 4 Cas9 (D10A).
EMBL Accession number: -
Latest sequence update: 23/03/2017
Sequence detail:
Sequence of the human TRAF2 CRISPR guide RNA:

GTGGCCACACTGCGCCTGGA
Authenticity test: The plasmid still needs to be subjected to the authenticity test.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: The plasmid was deposited by Prof. Dr R. Beyaert(1)(2). It was constructed by Dr. N. Harper(3).
(1) Center for Inflammation Research, VIB, Ghent, Belgium
(2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium
(3) Institute of Translational Medicine, University of Liverpool, Liverpool, United Kingdom
Plasmid reference: -
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 DH5α
Host reference: Focus 8 (1986), 9
Related host reference: Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660]
Rodriguez-Quinones et al., Focus 15 (1993), 110-112
Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791] [DOI: 10.1016/s0022-2836(83)80284-8]
Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187]
Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051]
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Other culture collection numbers: -

Refer in your Materials and Methods:

pX335-hTRAF2-CRISPR-4-Cas9(D10A) (LMBP 9421) is available at BCCM/GeneCorner. The plasmid was deposited by Prof. Dr R. Beyaert.

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search