Last data update: 24 January 2024 16:39 CET
Plasmid name: pBluhCASP-6 (LMBP 3814)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner core plasmid |
| GeneCorner sequence: |
p3814.gb
(View with Genome Compiler) p3814.pdf |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Human cysteinyl aspartate specific proteinase 6 cDNA (caspase-6, hCASP-6, Mch2) |
| Promoter: | Phage T7 gene 10 promoter (T7g10) Phage T3 promoter Escherichia coli lac operon promoter |
| Ribosome binding site: |
- |
| Terminator: | - |
| Selection marker: | Ampicillin (amp) |
| Replicon: | Escherichia coli plasmid pMB1 origin Phage f1 origin |
| Host range: | Escherichia coli |
| Parental clone: | pBluescriptIISK- |
| Further information: | The plasmid was constructed as follows: (I) the coding sequence of human caspase 6 (hCASP-6) was amplified by PCR from the human JURKAT cell line, (ii) the 252 bp EcoRI/BglII fragment of this PCR amplicon was inserted between the EcoRI and BglII sites of EST clone #84689, to fill up the 5'-incomplete hCASP-6 cDNA fragment. When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide. The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727398.1. The nucleotide sequence of hCASP-6 corresponds with the Genbank accession number U20536.1. Other name of the plasmid is pbluemch2#1. |
| EMBL Accession number: | U20536.1, view at EMBL, GenBank, DDBJ LT727398.1, view at EMBL, GenBank, DDBJ |
| Latest sequence update: | 20/04/1999 |
| Sequence detail: | forward primer: 5' GCGGAATTCTCGAGCTGCA.ATG.AGC.TCG.GCC.TCG.GG 3'
XhoI
EcoRI
reverse primer: 5' GCACCGCGGCCGCATTAGATTTTGGAAAGAAATGCAGC 3'
NotI
5' adaptor sequence of the EST clone: GAATTCGGCACGAG
EcoRI
3' adaptor sequence of the EST clone: CTCGAGTn
XhoI |
| Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: EcoRI, NotI, RsaI and XhoI. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Prof. Dr P. Vandenabeele(1)(2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | - |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 DH5α |
| Host reference: | Focus 8 (1986), 9 |
| Related host reference: | Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660] Rodriguez-Quinones et al., Focus 15 (1993), 110-112 Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791] [DOI: 10.1016/s0022-2836(83)80284-8] Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187] Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Cultivation remark: | - |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pBluhCASP-6 (LMBP 3814) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr P. Vandenabeele. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.