Last data update: 24 January 2024 16:39 CET
Plasmid name: pEF1-mRIP (LMBP 4720)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner core plasmid |
| GeneCorner sequence: |
p4720.gb
(View with Genome Compiler) p4720.txt p4720.pdf |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Mouse receptor TNFRSF-interacting serine-threonine kinase 1 cDNA (Ripk1, Rip1, Rinp, GeneID 19766) V5 epitope; C-terminal Histidine tag (His-tag); C-terminal |
| Promoter: | Human elongation factor 1α promoter (EF1α) Phage T7 gene 10 promoter (T7g10) Simian virus 40 early promoter (SV40 early) Escherichia coli lac operon promoter |
| Ribosome binding site: |
- |
| Terminator: | Bovine growth hormone polyadenylation signal (BGH polyA) Simian virus 40 polyadenylation signal (SV40 polyA) |
| Selection marker: | Ampicillin (amp) Neomycin (neo; G418) |
| Replicon: | Escherichia coli plasmid pMB1 origin Phage f1 origin Simian virus 40 bidirectional origin (SV40) |
| Host range: | Escherichia coli Mammalian cells; SV40 permissive cells |
| Parental clone: | pEF1/V5-HisA |
| Further information: | pEF1-mRIP was constructed by inserting a BamHI-XbaI fragment, containing the mRIP1 coding sequence, between the BamHI and XbaI sites of pEF1/V5-HisA. Because of the presence of the mRIP1 termination codon, the C-terminal V5 epitope and histidine tag are not expressed. pEF1-mRIP is designed for high-level expression of mRIP1 in mammalian cells. There is uncertainty about the presence of a second enhancer in the SV40 early promoter. The absence of a second enhancer in this promoter may cause bacterial leakage expression of the Tn5 neomycin resistance gene. This would cause transformed E. coli cells to be resistant to kanamycin, although growth should be reduced compared to growth on medium containing ampicillin. The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727176.1. The nucleotide sequence of the mRIP1 cDNA corresponds with the EMBL Nucleotide Sequence Database accession number BC058162.1. |
| EMBL Accession number: | BC058162.1, view at EMBL, GenBank, DDBJ LT727176.1, view at EMBL, GenBank, DDBJ |
| Latest sequence update: | 06/10/2003 |
| Sequence detail: | Nucleotide sequence at the start of the mRIP1 cDNA:
------------------------ mRIP1 ------------------------>
5' ... TGGTACCGAGCTCGGATCC.ATG.CAA.CCA.GAC.ATG.TCC.TTG.GAC.AAT.ATT.AAG.ATG.GCA.TCC ... 3'
KpnI BamHI *** Gln Pro Asp Met Ser Leu Asp Asn Ile Lys Met Ala Ser
StyI SspI
Nucleotide sequence at the end of the mRIP1 cDNA:
---------- mRIP1 ----------> ------------------ V5 epitope
5' ... ATT.CGT.GCC.AGC.CAG.AGC.TAA.TCTAGAGGGCCCTTCGAAGGTAAGCCTATCCCTAACCCTCTCCTCGG
Ile Arg Ala Ser Gln Ser +++ XbaI ApaI AsuII
------------> ---- His-tag ---->
TCTCGATTCTACGCGTACCGGTCATCATCACCATCACCATTGAGTTTAAAC ... 3'
MluI AgeI PmeI
***: Start codon.
+++: Termination codon.
Punctuation indicates reading frame. |
| Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: BamHI, BglII/XbaI, HindII, NcoI/SalI, SacI and SphI. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by T. Vanden Berghe(1) (2) and Prof. Dr P. Vandenabeele(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | - |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 MC1061 |
| Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
| Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Cultivation remark: | - |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pEF1-mRIP (LMBP 4720) is available at BCCM/GeneCorner. This plasmid was deposited by T. Vanden Berghe and Prof. Dr P. Vandenabeele . |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.