Last data update: 24 January 2024 16:39 CET
Plasmid name: pEF1hCASP-9-His (LMBP 5287)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner core plasmid |
| GeneCorner sequence: |
p5287.gb
(View with Genome Compiler) p5287.txt p5287.pdf |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Human cysteinyl aspartate specific proteinase 9 cDNA (caspase-9, CASP-9, APAF3, ICE-LAP6, MCH6, CASP9) V5 epitope; C-terminal Histidine tag (His-tag); C-terminal |
| Promoter: | Human elongation factor 1α promoter (EF1α) Phage T7 gene 10 promoter (T7g10) Simian virus 40 early promoter (SV40 early) Escherichia coli lac operon promoter |
| Ribosome binding site: |
- |
| Terminator: | Bovine growth hormone polyadenylation signal (BGH polyA) Simian virus 40 polyadenylation signal (SV40 polyA) |
| Selection marker: | Ampicillin (amp) Neomycin (neo; G418) |
| Replicon: | Escherichia coli plasmid pMB1 origin Phage f1 origin Simian virus 40 bidirectional origin (SV40) |
| Host range: | Escherichia coli Mammalian cells; SV40 permissive cells |
| Parental clone: | pEF1/V5-HisA |
| Further information: | The plasmid was constructed by inserting a 1258 bp EcoRI/XbaI fragment, containing the hCASP-9 cDNA, between the EcoRI and XbaI sites of pEF1/V5-HisA. As a result, hCASP-9 was fused in phase to the C-terminal V5 epitope and His-tag. pEF1hCASP-9-His is designed for high-level expression of the fusion protein under control of the hEF1α promoter in mammalian cells. There is uncertainty about the presence of a second enhancer in the SV40 early promoter. The absence of a second enhancer in this promoter may cause bacterial leakage expression of the Tn5 neomycin resistance gene. This would cause transformed E. coli cells to be resistant to kanamycin, although growth should be reduced compared to growth on medium containing ampicillin. The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727003.1. The nucleotide sequence of the hCASP-9 cDNA corresponds with the EMBL Nucleotide Sequence Database accession number U56390.1. Other name of the plasmid is pEF1hcasp-9HIS6. |
| EMBL Accession number: | U56390.1, view at EMBL, GenBank, DDBJ LT727003.1, view at EMBL, GenBank, DDBJ |
| Latest sequence update: | 23/10/2008 |
| Sequence detail: | Nucleotide sequence of the fusion gene:
-- T7 promoter ->
5' ... TAATACGACTCACTATAGGGAGACCCAAGCTGGCTAGGTAAGCTTGGTACCGAGCTCGGATCCACTAGTCCAGTGTGGT
HindIII SacI BamHI SpeI BstXI
KpnI
----------------- hCASP-9 ---------------->
1 416
GGAATTCCGCC.ATG.GAC.GAA.GCG.GAT ... TTC.TTT.AAA.ACA.TCA.TCT.AGA.GGG.CCC.TTC.GAA
EcoRI *** Asp Glu Ala Asp Phe Phe Lys Thr Ser Ser Arg Gly Pro Phe Glu
NcoI XbaI ApaI Csp45I
-------------------- V5 epitope ----------------------> ------- His
GGT.AAG.CCT.ATC.CCT.AAC.CCT.CTC.CTC.GGT.CTC.GAT.TCT.ACG.CGT.ACC.GGT.CAT.CAT.CAC
Gly Lys Pro Ile Pro Asn Pro Leu Leu Gly Leu Asp Ser Thr Arg Thr Gly His His His
MluI AgeI
tag ------>
CAT.CAC.CAT.TGA.GTTTAAACCCGCTGATCA ... 3'
His His His +++
***: start codon.
+++: termination codon.
Punctuation indicates reading frame. |
| Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: AatII/PdmI, AdeI/CaiI, EcoRI/XbaI, NcoI/SalI and SspI. As compared to the compiled nucleotide sequence, the restriction site analysis pattern revealed that EcoRI or XbaI cuts twice instead of once; the 6135 bp EcoRI/XbaI fragment is splitted into two fragments of approximately 5300 bp and 800 bp respectively. The exact location of the extra EcoRI or XbaI site in the vector part has not been determined; consequently, the compiled nucleotide sequence has not been adapted. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Prof. Dr P. Vandenabeele(1) (2). It was constructed by Dr X. Saelens(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | - |
| Related plasmid reference: | Lamkanfi et al., J. Biol. Chem. 280 (2005), 6923-6932 [PMID: 15590671] |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 MC1061 |
| Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
| Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Cultivation remark: | - |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pEF1hCASP-9-His (LMBP 5287) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr P. Vandenabeele . |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.