Last data update: 24 January 2024 16:39 CET
Plasmid name: pEF1mBID (LMBP 4325)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner core plasmid |
| GeneCorner sequence: |
p4325.gb
(View with Genome Compiler) p4325.txt p4325.pdf |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Mouse BH3 interacting domain death agonist (BID) V5 epitope; C-terminal Histidine tag (His-tag); C-terminal |
| Promoter: | Human elongation factor 1α promoter (EF1α) Phage T7 gene 10 promoter (T7g10) Simian virus 40 early promoter (SV40 early) Escherichia coli lac operon promoter |
| Ribosome binding site: |
- |
| Terminator: | Bovine growth hormone polyadenylation signal (BGH polyA) Simian virus 40 polyadenylation signal (SV40 polyA) |
| Selection marker: | Ampicillin (amp) Neomycin (neo; G418) |
| Replicon: | Escherichia coli plasmid pMB1 origin Phage f1 origin Simian virus 40 bidirectional origin (SV40) |
| Host range: | Escherichia coli Mammalian cells; SV40 permissive cells |
| Parental clone: | pEF1/V5-HisC; pGAD424mBID |
| Further information: | The plasmid was constructed by inserting the EcoRI/AspI(Tth111I, filled in) fragment of pGAD424mBID between the EcoRI and EcoRV sites of pEF1/V5-HisC. Because of the presence of the mouse BID termination codon, the C-terminal V5 epitope and histidine tag are not expressed. Unlike pcDNA3, pEF1mBID has not been shown to provide resistance to kanamycin. The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727184.1. The nucleotide sequence of the mouse BID cDNA corresponds with the EMBL Nucleotide Sequence Database accession number U75506.1. The presence of a second enhancer in the SV40 early promoter was shown by sequence analysis at LMBP. Other name of the plasmid is pEF1/V5HisCmBID no His/V5 tag. |
| EMBL Accession number: | U75506.1, view at EMBL, GenBank, DDBJ LT727184.1, view at EMBL, GenBank, DDBJ |
| Latest sequence update: | 11/06/2004 |
| Sequence detail: | Nucleotide sequence at the start of the mouse BID cDNA:
----------------- mBID ---------------->
5' ... TCGGATCCACTAGTCCAGTGTGGTGGAATTC.ATG.GAC.TCT.GAG.GTC.AGC.AAC.GGT.TCC.GGC ... 3'
BamHI SpeI BstXI EcoRI *** Asp Ser Glu Val Ser Asn Gly Ser Gly
Nucleotide sequence at the end of the mouse BID cDNA:
--------- mBID --------> ---------------
5' ... AGA.AAC.GAG.ATG.GAC.TGA.TCCAGCACAGTGGCGGCCGCTCGAGGTCACCCATTCGAAGGTAAGCCTATCCCT
Arg Asn Glu Met Asp +++ BstXI NotI XhoI AsuII
V5 epitope ---------------> ---- His-tag ---->
AACCCTCTCCTCGGTCTCGATTCTACGCGTACCGGTCATCATCACCATCACCATTGAGTTTAAAC ... 3'
MluI AgeI PmeI
***: start codon.
+++: termination codon.
Punctuation indicates reading frame. |
| Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: EcoRI, XhoI and XmnI. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by M. Van Gurp(1) (2) and Prof. Dr P. Vandenabeele(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | - |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 MC1061 |
| Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
| Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Cultivation remark: | - |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pEF1mBID (LMBP 4325) is available at BCCM/GeneCorner. This plasmid was deposited by M. Van Gurp and Prof. Dr P. Vandenabeele . |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.