Last data update: 24 January 2024 16:39 CET
Plasmid name: pEF6/E-Myc-HisA (LMBP 4743)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner core plasmid |
| GeneCorner sequence: |
p4743.gb
(View with Genome Compiler) p4743.txt p4743.pdf |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Mouse cysteinyl aspartate specific proteinase 1 cDNA (caspase-1, CASP-1, ICE, Casp1); stuffer fragment E-tag; N-terminal Myc epitope; C-terminal Histidine tag (His-tag); C-terminal |
| Promoter: | Human elongation factor 1α promoter (EF1α) Phage T7 gene 10 promoter (T7g10) Simian virus 40 early promoter (SV40 early) Synthetic prokaryotic EM7 promoter Escherichia coli lac operon promoter |
| Ribosome binding site: |
- |
| Terminator: | Bovine growth hormone polyadenylation signal (BGH polyA) Simian virus 40 polyadenylation signal (SV40 polyA) |
| Selection marker: | Ampicillin (amp) Blasticidin (bsd) |
| Replicon: | Escherichia coli plasmid pMB1 origin Phage f1 origin Simian virus 40 bidirectional origin (SV40) |
| Host range: | Escherichia coli; preferably recombination-deficient and endonuclease A deficient strains Mammalian cells; SV40 permissive cells |
| Parental clone: | pEF6/Myc-HisA; pCAGGS-EmCASP-1m3 |
| Further information: | The plasmid was constructed by inserting the small EcoRI fragment of pCAGGS-EmCASP-1m3, containing an initiation codon, the E-tag and 256 nucleotides of mouse caspase-1 cDNA, into the EcoRI site of pEF6/Myc-HisA. The mCASP-1 fragment only has a stuffer function. The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727183.1. Other name of the plasmid is pEF6-Etag. |
| EMBL Accession number: | LT727183.1, view at EMBL, GenBank, DDBJ |
| Latest sequence update: | 06/11/2003 |
| Sequence detail: | Nucleotide sequence around the E-tag:
T7 promoter --->
5' ... ATACGACTCACTATAGGGAGACCCAAGCTGGCTAGGTAAGCTTGGTACCGAGCTCGGATCCACTAGTCC
HindIII SacI BamHI SpeI BstXI
KpnI
--------------------- E-tag -------------------
AGTGTGGTGGAATTCCACC.ATG.GGT.GCG.CCG.GTG.CCG.TAT.CCG.GAC.CCG.CTG.GAA.CCG.
EcoRI *** Gly Ala Pro Val Pro Tyr Pro Asp Pro Leu Glu Pro
NcoI
--> ----- mCASP-1f ---->
CGT.GCG.GCC.GCT.GAC.AAG ... 3'
Arg Ala Ala Ala Asp Lys
NotI
Nucleotide sequence around the Myc epitope and the His-tag:
5' ... GAA.TTC.TGC.AGA.TAT.CCA.GCA.CAG.TGG.CGG.CCG.CTC.GAG.TCT.AGA.GGG.CCC.TTC.
Glu Phe Cys Arg Tyr Pro Ala Gln Trp Arg Pro Leu Glu Ser Arg Gly Pro Phe
EcoRI PstI EcoRV BstXI NotI XhoI XbaI ApaI AsuII
------------- Myc epitope ------------> ------ His-
GAA.CAA.AAA.CTC.ATC.TCA.GAA.GAG.GAT.CTG.AAT.ATG.CAT.ACC.GGT.CAT.CAT.CAC.
Glu Gln Lys Leu Ile Ser Glu Glu Asp Leu Asn Met His Thr Gly His His His
AgeI
tag ------>
CAT.CAC.CAT.TGA.GTTTAAACCCGCTGATCAGCCTCGA ... 3'
His His His +++ PmeI
***: start codon.
+++: termination codon.
Punctuation indicates reading frame. |
| Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: Alw44I/PvuII, DraI, HincII and KpnI. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Prof. Dr P. Vandenabeele(1) (2). It was constructed by B. Depuydt(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | - |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 MC1061 |
| Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
| Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Cultivation remark: | - |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pEF6/E-Myc-HisA (LMBP 4743) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr P. Vandenabeele . |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.