Last data update: 24 January 2024 16:39 CET
Plasmid name: pEF6-Etag-mcPLA2 (LMBP 4930)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner core plasmid |
| GeneCorner sequence: |
p4930.gb
(View with Genome Compiler) p4930.txt p4930.pdf |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Mouse cytosolic, calcium-dependent phospholipase A2 cDNA (cPLA2, Pla2g4a) E-tag; N-terminal Myc epitope; C-terminal Histidine tag (His-tag); C-terminal |
| Promoter: | Human elongation factor 1α promoter (EF1α) Phage T7 gene 10 promoter (T7g10) Simian virus 40 early promoter (SV40 early) Synthetic prokaryotic EM7 promoter Escherichia coli lac operon promoter |
| Ribosome binding site: |
- |
| Terminator: | Bovine growth hormone polyadenylation signal (BGH polyA) Simian virus 40 polyadenylation signal (SV40 polyA) |
| Selection marker: | Ampicillin (amp) Blasticidin (bsd) |
| Replicon: | Escherichia coli plasmid pMB1 origin Phage f1 origin Simian virus 40 bidirectional origin (SV40) |
| Host range: | Escherichia coli; preferably recombination-deficient and endonuclease A deficient strains Mammalian cells; SV40 permissive cells |
| Parental clone: | pEF6-E-hPKR-KD-K296R; pdKCRNeoMPLA2 |
| Further information: | The plasmid was constructed by inserting a 2257 bp NotI-XbaI fragment, obtained by PCR on pdKCRNeoMPLA2 and containing the mcPLA2 coding sequence, between the NotI and XbaI sites of pEF6-E-hPKR-KD-K296R. Because of the presence of the mcPLA2 termination codon, the C-terminal Myc epitope and His-tag are not expressed. The plasmid is designed for high-level expression of mcPLA2, fused to the N-terminal E-tag, in mammalian cells. pEF6-Etag-mcPLA2 carries the ampicillin resistance gene for selection in E. coli and the blasticidin resistance gene for selection in both E. coli and mammalian cells. The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727058.1. The nucleotide sequence of the mcPLA2 cDNA corresponds with the Genbank accession number NM_008869.3 and adapted to the sequence analysis results of the Department of Biomedical Molecular Biology (Ghent University, Belgium). Six differences are observable but these are not resulting in amino acid replacements. |
| EMBL Accession number: | NM_008869.3, view at GenBank LT727058.1, view at EMBL, GenBank, DDBJ |
| Latest sequence update: | 29/03/2005 |
| Sequence detail: | Primers used to amplify mcPLA2:
forward primer: 5' ATAAGAATGCGGCCGCT.ATG.TCT.TTC.ATA.G 3'
NotI ***
reverse primer: 5' GCTCTAGACC.TTA.CAC.AGT.GGG.TTT.AC 3'
XbaI +++
Nucleotide sequence of the fusion gene:
-- T7 promoter ->
5' ... TAATACGACTCACTATAGGGAGACCCAAGCTGGCTAGGTAAGCTTGGTACCGAGCTCGGATCCACTAGTCCAGTG
HindIII SacI BamHI SpeI BstXI
KpnI
---------------------- E-tag --------------------->
TGGTGGAATTCCACC.ATG.GGT.GCG.CCG.GTG.CCG.TAT.CCG.GAC.CCG.CTG.GAA.CCG.CGT.GCG
EcoRI Met Gly Ala Pro Val Pro Tyr Pro Asp Pro Leu Glu Pro Arg Ala
*** NotI
NcoI
----------------- mcPLA2 -----------------> ------
GCC.GCT.ATG.TCT.TTC.ATA.GAT ... AAA.CCC.ACT.GTG.TAA.GGTCTAGAGGGCCCTTCGAACAA
Ala Ala Met Ser Phe Ile Asp Lys Pro Thr Val +++ XbaI ApaI
-- Myc epitope --------> ---- His-tag ---->
AAACTCATCTCAGAAGAGGATCTGAATATGCATACCGGTCATCATCACCATCACCATTGAGTTTAAAC ... 3'
AgeI PmeI
***: Start codon.
+++: Termination codon.
Punctuation indicates reading frame. |
| Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: BamHI/PvuII, BspTI/HincII, EcoRI/PvuI, EcoRI/XbaI, NcoI/SspI, NotI and PvuI/XbaI. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Prof. Dr P. Vandenabeele(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | - |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 MC1061 |
| Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
| Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) + blasticidin (100 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Cultivation remark: | - |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pEF6-Etag-mcPLA2 (LMBP 4930) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr P. Vandenabeele . |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.