Last data update: 24 January 2024 16:39 CET
Plasmid name: pENTR-L4R1-hCMV (LMBP 8997)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner core plasmid |
| GeneCorner sequence: |
p8997.gb
(View with Genome Compiler) p8997.txt p8997.pdf |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
- |
| Promoter: | Human cytomegalovirus immediate early promoter (CMV-IE) and enhancer Phage T7 gene 10 promoter (T7g10) |
| Ribosome binding site: |
- |
| Terminator: | Escherichia coli rrnB operon T1 terminator Escherichia coli rrnB operon T2 terminator |
| Selection marker: | Neomycin (neo; kanamycin (kan)) |
| Replicon: | Escherichia coli plasmid pMB1 origin |
| Host range: | Escherichia coli |
| Parental clone: | pDONR-P4P1r; pcDNA3 |
| Further information: | This Gateway entry vector was constructed by Gateway B/P reaction between pDONR-P4P1r (Invitrogen) and the PCR-amplified human CMV-IE promoter region from pcDNA3, with attenuator sites attB4 and attB1r added to the forward and reverse primer respectively. The vector contains the human CMV-IE promoter and enhancer between the attenuator sites attL4 and attR1. The region downstream of the T7 promoter, containing the Gateway cassette, has been sequenced by BCCM/GeneCorner. |
| EMBL Accession number: | - |
| Latest sequence update: | 03/02/2014 |
| Sequence detail: | Primers used to amplify the human CMV-IE promoter and enhancer:
<-- attB4 -->| |<-- hCMV-IE promoter and enhancer
Forward: 5' GGGGACAACTTTGTATAGAAAAGTTG|TT|GACATTGATTATTGACTAGTTATTAATAGTA
<-- attB1r -->|<-- hCMV-IE promoter and enhancer
Reverse: 5' GGGGACTGCTTTTTTGTACAAACTTG|GAGCTCTGCTTATATAGACCT |
| Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: NdeI and SacI. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Dr M. De Ceuleneer(1) and Prof. Dr R. Beyaert(1). (1) BCCM/GeneCorner, Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | - |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 DH5α |
| Host reference: | Focus 8 (1986), 9 |
| Related host reference: | Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660] Rodriguez-Quinones et al., Focus 15 (1993), 110-112 Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791] [DOI: 10.1016/s0022-2836(83)80284-8] Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187] Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051] |
| Cultivation medium: | LB-Lennox + kanamycin (50 μg/ml) |
| Cultivation temperature: | 28°C |
| Biosafety level: | L1 |
| Cultivation remark: | - |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pENTR-L4R1-hCMV (LMBP 8997) is available at BCCM/GeneCorner. This plasmid was deposited by Dr M. De Ceuleneer and Prof. Dr R. Beyaert. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.