Last data update: 24 January 2024 16:39 CET
Plasmid name: pGEXGSTp65(12-317)S276C (LMBP 5056)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner core plasmid |
| GeneCorner sequence: |
p5056.gb
(View with Genome Compiler) p5056.txt p5056.pdf |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Schistosoma japonicum Sj26 antigen glutathione S-transferase gene (GST) Thrombin recognition site; N-terminal Human nuclear factor κB cDNA (NF-κB); mutated fragment of the p65 (RELA) subunit Escherichia coli lac repressor gene (lacI) Escherichia coli lac Z gene (lacZ); fragment, incl. α part |
| Promoter: | Escherichia coli hybrid tryptophan/lacUV5 promoter (tac) Escherichia coli lac repressor promoter; mutant (lacI(q)) Escherichia coli lac operon promoter |
| Ribosome binding site: |
Ribosome binding site (RBS) of the Escherichia coli lac Z gene (lacZ) |
| Terminator: | - |
| Selection marker: | Ampicillin (amp) |
| Replicon: | Escherichia coli plasmid pMB1 origin |
| Host range: | Escherichia coli |
| Parental clone: | pGEXGSTp65(12-317); pGal4-p65S276C |
| Further information: | The plasmid was constructed by inserting the 791 bp NdeI/SacII fragment of pGal4-p65S276C between the NdeI/SacII sites of pGEXGSTp65(12-317). As a result, the mutated hNF-κB p65 subunit fragment that encodes amino acids 12 up to and including 317 was fused in phase to the N-terminal coding sequence of the S. japonicum GST gene and the N-terminal thrombin recognition sequence. As compared to the wt hNF-κB p65 subunit, the serine codon at position 276 is replaced by a cysteine codon; furthermore, an additional StuI site is present due to a silent mutation of the arginin codon at position 274, replacing CGG by AGG. Transcription of the GST-p65(12-317)S276C fusion gene is controlled by the binding of the lac repressor, encoded by the lacI gene, to the lac operator of the E. coli tac promoter. pGEXGSTp65(12-317)S276C can be used for the synthesis of the GST-p65(12-317)S276C fusion protein in E. coli. The GST carrier can be cleaved from the fusion protein by digestion with the site-specific protease thrombin. The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727076.1. The nucleotide sequence of the pGEX-T2 vector corresponds with the EMBL Nucleotide Sequence Database accession number U13850.1. The nucleotide sequence of the wild type hNF-κB p65 coding sequence corresponds with the EMBL Nucleotide Sequence Database accession number M62399.1. Other name of the plasmid is pGEX-p65-S276C. |
| EMBL Accession number: | U13850.1, view at EMBL, GenBank, DDBJ M62399.1, view at EMBL, GenBank, DDBJ LT727076.1, view at EMBL, GenBank, DDBJ |
| Latest sequence update: | 27/07/2005 |
| Sequence detail: | Nucleotide sequence of the fusion gene:
-------------- tac promoter ---------->------------- lacZ RBS ------------>
5' ... GTTGACAATTAATCATCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGTA
HindII
----------------------- GST ----------------------> -- thrombin
TTC.ATG.TCC.CCT.ATA.CTA.GGT ... GGC.GAC.CAT.CCT.CCA.AAA.TCG.GAT.CTG.GTT.CCG
Met Ser Pro Ile Leu Gly Gly Asp His Pro Pro Lys Ser Asp Leu Val Pro
***
recogn. --> --------------------------------- p65fm -----------------------
12 276
CGT.GGA.TCC.GAG.CCA.GCC.CAG.GCC.TCT ... AGG.CCT.TGC.GAC.CGG ... ATC.ATG.AAG
Arg Gly Ser Glu Pro Ala Gln Ala Ser Arg Pro Cys Asp Arg Ile Met Lys
^BamHI StuI * *
StuI
---------->
317
AAG.AGT.CCT.GGA.TCC.CCG.GGA.ATT.CAT.CGT.GAC.TGA.CTGACGATCTGCCTC ... 3'
Lys Ser Pro Gly Ser Pro Gly Ile His Arg Asp +++
BamHI AvaI EcoRI
^: thrombin cleavage site.
***: start codon.
+++: termination codon.
*: mutated nucleotide.
Punctuation indicates reading frame. |
| Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: BamHI, BglI/HindII, EcoRV, NdeI/SacII, PvuI and StuI/XmnI. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Dr L. Vermeulen(1) and Prof. Dr G. Haegeman(1). (1) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | Vermeulen et al., EMBO J. 22 (2003), 1313-1324 [PMID: 12628924] |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 MC1061 |
| Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
| Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Cultivation remark: | - |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pGEXGSTp65(12-317)S276C (LMBP 5056) is available at BCCM/GeneCorner. This plasmid was deposited by Dr L. Vermeulen and Prof. Dr G. Haegeman and was published in Vermeulen et al., 2003. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.