Last data update: 24 January 2024 16:39 CET
Plasmid name: pGEXGSTp65(285-551) (LMBP 5057)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner core plasmid |
| GeneCorner sequence: |
p5057.gb
(View with Genome Compiler) p5057.txt p5057.pdf |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Schistosoma japonicum Sj26 antigen glutathione S-transferase gene (GST) Blood coagulation factor Xa recognition site; N-terminal Human nuclear factor κB cDNA (NF-κB); fragment of the p65 (RELA) subunit Escherichia coli lac repressor gene (lacI) Escherichia coli lac Z gene (lacZ); fragment, incl. α part |
| Promoter: | Escherichia coli hybrid tryptophan/lacUV5 promoter (tac) Escherichia coli lac repressor promoter; mutant (lacI(q)) Escherichia coli lac operon promoter |
| Ribosome binding site: |
Ribosome binding site (RBS) of the Escherichia coli lac Z gene (lacZ) |
| Terminator: | - |
| Selection marker: | Ampicillin (amp) |
| Replicon: | Escherichia coli plasmid pMB1 origin |
| Host range: | Escherichia coli |
| Parental clone: | pGEX-5X-1; pGal4-p65f286-550 |
| Further information: | The plasmid was constructed by inserting the 809 bp BsaHI-EcoRI fragment of pGal4-p65f286-550, containing the human NF-κB p65 cDNA fragment encoding the amino acids 285 up to and including 551, between the EcoRI-AccI sites of pGEX-5X-1. As a result, the p65(285-551) coding sequence was fused in phase to the N-terminal coding sequence of the S. japonicum GST gene and the N-terminal recognition sequence for the blood coagulation factor Xa. Transcription of the GST-p65(285-551) fusion gene is controlled by the binding of the lac repressor, encoded by the lacI gene, to the lac operator of the E. coli tac promoter. pGEXGSTp65(285-551) can be used for the synthesis of the GST-p65(285-551) fusion protein in E. coli. The GST carrier can be cleaved from the fusion protein by digestion with the site-specific protease Xa. The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727077.1. The nucleotide sequence of the pGEX-5X-1 vector corresponds with the EMBL Nucleotide Sequence Database accession number U13856.1. The nucleotide sequence of the human NF-κB p65 coding sequence corresponds with the EMBL Nucleotide Sequence Database accession number M62399.1. Name mentioned in Delerive et al. (1999) is pGexp65 286-551. Other name of the plasmid is pGEX-p65dN. |
| EMBL Accession number: | U13856.1, view at EMBL, GenBank, DDBJ M62399.1, view at EMBL, GenBank, DDBJ LT727077.1, view at EMBL, GenBank, DDBJ |
| Latest sequence update: | 27/07/2005 |
| Sequence detail: | Nucleotide sequence of the fusion gene:
-------------- tac promoter ---------->------------- lacZ RBS ------------>
5' ... GTTGACAATTAATCATCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGTA
HindII
----------------------- GST ----------------------> ---- Xa
TTC.ATG.TCC.CCT.ATA.CTA.GGT ... GGC.GAC.CAT.CCT.CCA.AAA.TCG.GAT.CTG.ATC.GAA
Met Ser Pro Ile Leu Gly Gly Asp His Pro Pro Lys Ser Asp Leu Ile Glu
***
Xa ---> ---------------------- p65f ---------------------->
285 551
GGT.CGT.GGG.ATC.CCC.GAA.TTC.CAG.TAC.CTG.CCA ... AGT.CAG.ATC.AGC.TCC.TAA.GGG
Gly Arg Gly Ile Pro Glu Phe Gln Tyr Leu Pro Ser Gln Ile Ser Ser +++
^ BamHI EcoRI
GGTGACGACTCGAGCGGCCGCATCGTGACTGACTGACGATCTGCCTC ... 3'
XhoI NotI
^: Xa cleavage site.
***: start codon.
+++: termination codon.
Punctuation indicates reading frame. |
| Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: AccI/NarI, BamHI, BamHI/SspI, BglI/XmnI, BssHII/EcoRI, PvuI, SspI and XhoI. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Dr L. Vermeulen(1) and Prof. Dr G. Haegeman(1). It was constructed by S. Plaisance(1). (1) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | Delerive et al., J. Biol. Chem. 274 (1999), 32048-32054 [PMID: 10542237] |
| Related plasmid reference: | Vermeulen et al., EMBO J. 22 (2003), 1313-1324 [PMID: 12628924] Jaffray et al., Mol. Cell. Biol. 15 (1995), 2166-2172 [PMID: 7891711] |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 MC1061 |
| Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
| Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Cultivation remark: | - |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pGEXGSTp65(285-551) (LMBP 5057) is available at BCCM/GeneCorner. This plasmid was deposited by Dr L. Vermeulen and Prof. Dr G. Haegeman and was published in Delerive et al., 1999. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.