GREAT AT SMALL THINGS

0

GeneCorner plasmid details

Last data update: 24 January 2024 16:39 CET

Plasmid name: pGL3casp11p-Del8 (LMBP 5188)

Add to cart

New search Print data sheet
Price category: Cat. 1 (cf. price list)
Status: GeneCorner core plasmid
GeneCorner sequence: p5188.gb (View with Genome Compiler)
p5188.txt
p5188.pdf
Sequence
analysis results
Genecorner:

-

Cloned DNA: Photinus pyralis (firefly) luciferase gene (LUC); mutated coding region (LUCm; luc(+))
Promoter: Mouse cysteinyl aspartate specific proteinase 11 promoter (CASP-11); 48 bp fragment (CASP-11p-Del8)
Ribosome
binding site:
-
Terminator: Simian virus 40 polyadenylation signal (SV40 polyA)
Synthetic polyadenylation signal (polyA)
Selection marker: Ampicillin (amp)
Replicon: Escherichia coli plasmid pMB1 origin
Phage f1 origin
Host range: Escherichia coli
Mammalian cells
Parental clone: pGL3casp11p
Further information: The plasmid was constructed as follows: 1) the 48 bp mouse caspase-11 promoter fragment (mCASP-11p-Del8) + the first 25 nucleotides of the mouse caspase-11 mRNA were generated by PCR using pGL3casp11p as template; 2) the amplified DNA fragment was unidirectionally cloned between the MluI and NcoI sites of the pGL3-Basic vector.
The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT726958.1.
The nucleotide sequence of the mouse caspase-11 promoter fragment corresponds with the EMBL Nucleotide Sequence Database accession number AF539416.1.
Other name of the plasmid is pGL3-casp11p-Del8.
EMBL Accession number: AF539416.1, view at EMBL, GenBank, DDBJ
LT726958.1, view at EMBL, GenBank, DDBJ
Latest sequence update: 06/03/2007
Sequence detail:
The primers used in PCR to amplify the 48 bp mCASP-11p-Del8 fragment were:

Fwd : 5' CGACGCGTCTATGCTAAGGAAATGCCCAGTAAC 3'
           MluI

Rev : 5' CATGCCATGGCCTCAGTTCTTTCGCACTGTGAAGA 3'
             NcoI
Authenticity test: Restriction enzyme pattern analysed at GeneCorner: KpnI, MluI/NcoI and TatI.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Prof. Dr R. Beyaert(1) (2). It was constructed by Dr R. Schauvliege(1) (2).
(1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium
(2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium
Plasmid reference: Schauvliege et al., J. Biol. Chem. 277 (2002), 41624-41630 [PMID: 12198138]
Related plasmid reference: Sherf et al., Promega Notes Magazine 49 (1994), 14-21
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 MC1061
Host reference: Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493]
Related host reference: Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111]
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Cultivation remark: -
Other culture collection numbers: -

Refer in your Materials and Methods:

pGL3casp11p-Del8 (LMBP 5188) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr R. Beyaert and was published in Schauvliege et al., 2002.

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search