Last data update: 24 January 2024 16:39 CET
Plasmid name: pIVHAf8 (LMBP 1963)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner non-core plasmid |
| Depositor's sequence: | pivhaf8.gb |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Influenza A virus (A/Victoria/3/1975(H3N2)) haemagglutinin cDNA (HA, IVHA); 5' fragment |
| Promoter: | - |
| Ribosome binding site: |
- |
| Terminator: | - |
| Selection marker: | Ampicillin (amp) |
| Replicon: | Escherichia coli plasmid ColE1 origin |
| Host range: | Escherichia coli |
| Parental clone: | pBR322; pPLa2311; pIVHA |
| Further information: | The plasmid was constructed as follow : First the intermediate pSRFH-1 was made; pPLa2311 was opened in the unique EcoRI site and filled in, then it was cut in the unique HindIII site and the FnuDII-HindIII fragment of pIVHA, containing the signal peptide sequence and a part of the HA1 chain of the HA gene, was inserted. Subsequently, pSRFH-1 was unique EcoRI opened, Bal31 exonuclease treated, ClaI linkers were added and the ClaI-PstI fragment was substituted by the ClaI-PstI fragment of pBR322 to be sure of the ampicillin resistance; then, after a short Bal31 treatment on the opened ClaI site, SalI linkers were added. The difference with pIVHAf1 is the length between the SalI site and the start codon of HA (pIVHAf8 has 2 nucleotides less). The sequence from the unique SalI site towards HA was determined, but not in the anti-clockwise direction towards the unique EcoRI site; the presence of this unique EcoRI site was not confirmed. Name mentioned in Huylebroeck et al. (1988) is pSRΔS. Other name of the plasmid is pSRdelS8. |
| EMBL Accession number: | - |
| Latest sequence update: | 12/12/1989 |
| Sequence detail: | Nucleotide sequence between the SalI site and the start codon of the IVHA gene:
IVHA1 GTCGACCGGGATAATTCTATTAACC ATG.AAG.ACT
SalI *
IVHA8 GTCGACCGATAATTCTATTAACC ATG.AAG.ACT
SalI *
*: Start codon of the IVHA gene. |
| Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Prof. Dr W. Min Jou(1). (1) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | Huylebroeck et al., Gene 66 (1988), 163-181 [PMID: 2844629] |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12xB HB101 |
| Host reference: | Boyer and Roulland-Dussoix, J. Mol. Biol. 41 (1969), 459-472 [PMID: 4896022] |
| Related host reference: | Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791] [DOI: 10.1016/s0022-2836(83)80284-8] Sambrook et al. (eds), Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY (1989) [ISSN/ISBN: 0879693096] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pIVHAf8 (LMBP 1963) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr W. Min Jou and was published in Huylebroeck et al., 1988. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.