Last data update: 24 January 2024 16:39 CET
Plasmid name: pJBtrc (LMBP 3177)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner core plasmid |
| GeneCorner sequence: |
p3177.gb
(View with Genome Compiler) p3177.txt p3177.pdf |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Escherichia coli lac repressor gene (lacI) Broad-host-range plasmid RK2 trans-acting replication initiator protein DNA (trfA) |
| Promoter: | Escherichia coli hybrid tryptophan/lacUV5 promoter (trc) Escherichia coli lac repressor promoter; mutant (lacI(q)) Transposon Tn5 neomycin resistance gene promoter (neo) |
| Ribosome binding site: |
Ribosome binding site (RBS) of the Escherichia coli lac Z gene (lacZ) |
| Terminator: | - |
| Selection marker: | Tetracycline (tet) |
| Replicon: | Broad-host-range plasmid RK2 vegetative replication origin Broad-host-range plasmid RK2/RP4 origin of transfer (oriT) |
| Host range: | Escherichia coli Gram-negative bacterial strains |
| Parental clone: | pJB3tet2; pSE380 |
| Further information: | The plasmid was constructed by inserting the ScaI-DrdI fragment (blunted with Klenow DNA exonuclease) of pSE380, containing the trc promoter and the lacI(q) repressor cassette, between the BsaI (filled in with Klenow DNA polymerase) and ScaI sites of pJB3tet2. The ampicillin resistance of pJB3tet2 was lost due to the construction. This IncP plasmid is used as a broad-host-range expression vector. The plasmid RK2 trfA gene encodes two polypeptide products P382 and P285 of 382 and 285 amino acids respectively, using a different initiation codon within the same reading frame. The resulting protein is essential for vegetative replication. Introduce the plasmid by electroporation, or through conjugation, using plasmid RK2/RP4 transfer functions (provided in trans by RK2/RP4, RK2/RP4-derived vectors, other replicons carrying RK2/RP4 transfer functions (e.g. pRK2073) or strains expressing the tra genes of RK2/RP4). The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727449.1. |
| EMBL Accession number: | LT727449.1, view at EMBL, GenBank, DDBJ |
| Latest sequence update: | 16/03/1995 |
| Sequence detail: | Nucleotide sequence downstream from the trc promoter:
trc promoter ->|-> lac RBS lac RBS ->|
5' ... GTATAATGTGTGG AATTGTGAGCGGATAACAATTTCACACAGGAAACAG ACCATGG
***
NcoI
***: start codon. |
| Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: BglII, EcoRI, EcoRI/SfiI, NcoI, SfiI, SfiI/SphI, SphI, XbaI and XhoI. The results indicate that the plasmid is 500 to 700 bp larger than the compiled nucleotide sequence, the extra nucleotides being located in the 1796 bp SfiI/SphI fragment, most likely between the broad host range plasmid RK2 vegetative replication origin (oriV) and the E. coli lacI(q) repressor promoter as these extra nucleotides do not influence the functional features for vegetative replication. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Prof. Dr E. Remaut(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | - |
| Related plasmid reference: | Brosius et al., J. Biol. Chem. 260 (1985), 3539-3541 [PMID: 2579077] |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 MC1061 |
| Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
| Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
| Cultivation medium: | LB-Lennox + tetracycline (10 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Cultivation remark: | - |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pJBtrc (LMBP 3177) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr E. Remaut . |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.