GeneCorner plasmid details

Last data update: 28 November 2020 04:24 CET

Plasmid name: pCAGGSPyHIFNB2 (LMBP 2850)

Add to cart

New search

Price category: Cat. 1 (cf. price list)
Status: GeneCorner non-core plasmid
Depositor's sequence:
analysis results


Cloned DNA: Human interferon β gene (IFNB, IFNB1)
Promoter: Chicken β-actin/rabbit β-globin hybrid promoter (AG)
Human cytomegalovirus immediate early promoter (CMV-IE); enhancer only
Escherichia coli lac operon promoter
binding site:
Terminator: Rabbit β-globin polyadenylation signal (β-globin polyA)
Simian virus 40 polyadenylation signal (SV40 polyA)
Selection marker: Ampicillin (amp)
Replicon: Escherichia coli plasmid pMB1 origin
Simian virus 40 bidirectional origin (SV40)
Polyoma virus origin
Host range: Escherichia coli
Mammalian cells; SV40 permissive cells
Parental clone: pCAGGSPy; pSP64GSHIFBSNNT
Further information: The plasmid was constructed by inserting the EcoRI-HindIII fragment (sites filled in with Klenow DNA polymerase) of pSP64GSHIFNBSNNT, containing the human IFNβ gene, into the unique XhoI site (filled in with Klenow DNA polymerase) of pCAGGSPy. pSP64GSHIFNBSNNT is derived from pSP64GSHIFNBNT (SacI opened, blunted (T4 exonuclease) and ligated with the filled-in (Klenow DNA polymerase) NotI-SfiI linker).
pCAGGSPyHIFNB2 is useful for highly efficient expression of genes under the control of the AG promoter and the human CMV-IE enhancer in various mammalian cells.
The polyoma origin makes gene amplification in mouse cells possible.
Human IFNβ, used as a stuffer, can be excised as a SfiI fragment. The SfiI sites of the vector are non-compatible (repeated inverse).
When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide.
The nucleotide sequence of the hIFNβ cDNA corresponds with the EMBL Nucleotide Sequence Database accession number V00546.1.
Other name of the plasmid is pCAGGS-Pyori-Sfi-Sfi-hIFNB.
EMBL Accession number: V00546.1, view at EMBL, GenBank, DDBJ
Latest sequence update: 10/07/2000
Sequence detail:
Nucleotide sequence at the start of the human IFNß gene:

    HindIII       StuI           Met Thr Asn
         BalI         XhoI

Nucleotide sequence at the end of the insert:

       XhoI       NotI         BamHI           NotI       SfiI     
           StuI                     SmaI


Nucleotide sequence of the linkers:

 SfiI-NotI linker :   5' AGCTTGGCCAAAAAGGCCTAGCGGCCGC         3'
                      3'     ACCGGTTTTTCCGGATCGCCGGCGGATC     5'
Authenticity test: The plasmid still needs to be subjected to the authenticity test.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by S. Dewaele(1) (2) and Prof. Dr R. Contreras(1) (2).
(1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium
(2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium
Plasmid reference: -
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 MC1061
Host reference: Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493]
Related host reference: Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111]
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Other culture collection numbers: -

Refer in your Materials and Methods:

pCAGGSPyHIFNB2 (LMBP 2850) is available at BCCM/GeneCorner. This plasmid was deposited by S. Dewaele and Prof. Dr R. Contreras .

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search