Last data update: 24 January 2024 16:39 CET
Plasmid name: pCAT1 (LMBP 5032)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner core plasmid |
| GeneCorner sequence: |
p5032.gb
(View with Genome Compiler) p5032.pdf |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Nicotiana plumbaginifolia catalase 1 cDNA (CAT1); fragment (CAT1f) |
| Promoter: | Phage T7 gene 10 promoter (T7g10) Phage T3 promoter Escherichia coli lac operon promoter |
| Ribosome binding site: |
- |
| Terminator: | - |
| Selection marker: | Ampicillin (amp) |
| Replicon: | Escherichia coli plasmid pMB1 origin Phage f1 origin |
| Host range: | Escherichia coli |
| Parental clone: | pBluescriptIIKS+ |
| Further information: | The plasmid was constructed by inserting a 1064 bp fragment, containing the 3' region of the Nicotiana plumbaginifolia (tobacco) catalase 1 coding sequence (CAT1), into the EcoRV opened pBluescriptIIKS+ vector. When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide. The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727072.1. The nucleotide sequence of the pBluescriptIIKS+ vector corresponds with the Genbank accession number X52327.1. pBluescriptIIKS+ differs from pBluescriptIIKS- in the orientation of the f1 origin. The nucleotide sequence of the N. plumbaginifolia CAT1 cDNA corresponds with the Genbank accession number Z36975.1. |
| EMBL Accession number: | Z36975.1, view at EMBL, GenBank, DDBJ X52327.1, view at EMBL, GenBank, DDBJ LT727072.1, view at EMBL, GenBank, DDBJ |
| Latest sequence update: | 25/05/2005 |
| Sequence detail: | Nucleotide sequence of the inserted N. plumbaginifolia (tobacco) catalase 1 fragment:
-- T7 promoter ->
5' ... GCGTAATACGACTCACTATAGGGCGAATTGGAGCTCCACCGCGGTGGCGGCCGCTCTAGAACTAGTGGATC
NotI XbaI SpeI BamHI
--------------------- CAT1f --------------------->
218 492
CCCCGGGCTGCAGGAATTCGATGG.AAA.TCA.ACC.TAT.GTG ... GTG.AGA.CCA.AGC.ATA.TGA
AvaI PstI EcoRI Lys Ser Thr Tyr Val Val Arg Pro Ser Ile +++
XmaI NdeI
---------- 3'UTR of CAT1 --------->
AGATGAAGCTTTTAA ... TTTTCTTGTGCTATTATCAAGCTTATCGATACCGTCGACCTCGAGGGGGGGC
HindIII HindIII SalI XhoI ApaI
HindII
<- T3 promoter --
CCGGTACCCAGCTTTTGTTCCCTTTAGTGAGGGTTAATTGCG ... 3'
KpnI
+++: Termination codon.
: former EcoRV site.
Punctuation indicates reading frame. |
| Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: AvaI, BamHI, EcoRV, HindIII, KpnI and XmnI. As compared to the compiled nucleotide sequence, the restriction site analysis pattern revealed that BamHI cuts three times instead of two times, resulting in fragments of approx. 200 bp, 1000 bp and 3000 bp respectively. Consequently, the plasmid seems to be 100 à 150 bp larger than theoretically expected, probably due to a larger 3' UTR part of the insert. The compiled nucleotide sequence has not been adapted accordingly. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Prof. Dr D. Inzé(1) (2) and constructed by H. Willekens(1) (2). (1) Department of Plant Systems Biology, VIB, Ghent, Belgium (2) Department of Plant Systems Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | - |
| Related plasmid reference: | Willekens et al., FEBS Lett. 352 (1994), 79-83 [PMID: 7925949] |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 XL1-Blue |
| Host reference: | Bullock et al., BioTechniques 5 (1987), 376-379 |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Cultivation remark: | - |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pCAT1 (LMBP 5032) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr D. Inzé and constructed by H. Willekens . |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.