Last data update: 24 January 2024 16:39 CET
Plasmid name: pEF6-MycHis-FlaghCD14 (LMBP 5656)
New search | Print data sheet |
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner non-core plasmid |
Depositor's sequence: | not available |
Sequence analysis results Genecorner: |
- |
Cloned DNA: |
Human CD14 molecule cDNA Myc epitope Histidine tag (His-tag) FLAG epitope tag |
Promoter: | Human elongation factor 1α promoter (EF1α) Phage T7 gene 10 promoter (T7g10) Simian virus 40 early promoter (SV40 early) Synthetic prokaryotic EM7 promoter Escherichia coli lac operon promoter |
Ribosome binding site: |
- |
Terminator: | Bovine growth hormone polyadenylation signal (BGH polyA) Simian virus 40 polyadenylation signal (SV40 polyA) |
Selection marker: | Ampicillin (amp) Blasticidin (bsd) |
Replicon: | Escherichia coli plasmid pMB1 origin Phage f1 origin Simian virus 40 bidirectional origin (SV40) |
Host range: | Escherichia coli; preferably recombination-deficient and endonuclease A deficient strains Mammalian cells; SV40 permissive cells |
EMBL Accession number: | - |
Latest sequence update: | 28/01/2008 |
Sequence detail: | Forward primer: 5' GGACTAGTTCGACCATGGACTACAAGGACGACGATGACAAGATGGAGCGCGCGTCC 3' SpeI Reverse primer: 5' GCTCTAGATTAGGCAAAGCCCCG 3' XbaI |
Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | This plasmid was deposited by Dr S. Janssens(1) (2) and Prof. Dr R. Beyaert(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
Plasmid reference: | - |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 MC1061 |
Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
Cultivation temperature: | 37°C |
Biosafety level: | L1 |
Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pEF6-MycHis-FlaghCD14 (LMBP 5656) is available at BCCM/GeneCorner. This plasmid was deposited by Dr S. Janssens and Prof. Dr R. Beyaert . |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.