Last data update: 24 January 2024 16:39 CET
Plasmid name: pENTR-C-BGH-Blast (LMBP 9492)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner non-core plasmid |
| Depositor's sequence: | p9492.gb |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
- |
| Promoter: | Phage T7 gene 10 promoter (T7g10) |
| Ribosome binding site: |
- |
| Terminator: | Bovine growth hormone polyadenylation signal (BGH polyA) |
| Selection marker: | Blasticidin (bsd) Streptomycin (Sm; spectinomycin (Sp)) |
| Replicon: | Escherichia coli plasmid pMB1 origin |
| Host range: | Escherichia coli |
| Parental clone: | pEF6/Myc-HisA; pDONR-C-attP2rP3 |
| Further information: | This multisite Gateway Entry vector was constructed by PCR amplifying the BGH terminator and the blasticidin resistance gene from pEF6/Myc-HisA with primers containing attB2 and attB3 sites, and cloning this cassette into the pDONR-C vector via Gateway BP recombination. This plasmid can be used as transcription stop and selectable marker in multisite gateway clonings. |
| EMBL Accession number: | - |
| Latest sequence update: | 12/04/2017 |
| Sequence detail: | Primers used to isolate the BGH terminator and the blasticidin resistance gene:
<--- attB2R --->
Forward: 5' GGGGACAGCTTTCTTGTACAAAGTGGAACTGTGCCTTCTAGTTGCCAGC
<--- attB3 --->
Reverse: 5' GGGGACAACTTTGTATAATAAAGTTGTAAAAAATGCTTTATTTGTG |
| Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | The plasmid was deposited by Dr J. Staal(1)(2) and Prof. Dr R. Beyaert(1)(2). (1) VIB Center for Inflammation Research, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | - |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 DH5α |
| Host reference: | Focus 8 (1986), 9 |
| Related host reference: | Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660] Rodriguez-Quinones et al., Focus 15 (1993), 110-112 Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791] [DOI: 10.1016/s0022-2836(83)80284-8] Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187] Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051] |
| Cultivation medium: | LB-Lennox + spectinomycin (50 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Cultivation remark: | - |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pENTR-C-BGH-Blast (LMBP 9492) is available at BCCM/GeneCorner. The plasmid was deposited by Dr J. Staal and Prof. Dr R. Beyaert. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.