GREAT AT SMALL THINGS

51

GeneCorner plasmid details

Last data update: 24 January 2024 16:39 CET

Plasmid name: pLJM34 (LMBP 9310)

Add to cart

New search Print data sheet
Price category: Cat. 1 (cf. price list)
Status: GeneCorner non-core plasmid
Depositor's sequence: p9310.gb
Sequence
analysis results
Genecorner:

-

Cloned DNA: Yersinia enterocolitica outer membrane adhesin protein gene (yadA, P1, yopA); modified sequence (yadA545+)
Promoter: Escherichia coli lac operon promoter
Phage T7 gene 10 promoter (T7g10)
Phage T3 promoter
Ribosome
binding site:
Ribosome binding site (RBS) of the Escherichia coli lac Z gene (lacZ)
Terminator: -
Selection marker: Neomycin (neo; kanamycin (kan))
Replicon: Broad-host-range Gram-negative Bordetella bronchiseptica S87 plasmid pBBR1 replicon
Host range: Escherichia coli
Gram-negative bacterial strains
Parental clone: pBBR1MCS-2; pLJM32; pMS8
Further information: The plasmid was constructed by amplifying the yadA545+ CDS via inverse PCR on pLJM32 and cloning it into the pBBR1MCS-2 vector, followed by insertion of the PvuII fragment from pMS8 containing yadA686-956.
Other names of the plasmid are pBBRMCS2:yadA545+, pYadALONG and pYadA545.
EMBL Accession number: -
Latest sequence update: 03/07/2014
Sequence detail:
Primers used to create the yadA545+ CDS:

Forward: 5' CTGATTTTTTATTTGTATTTTCCTGT

Reverse: 5' CTGAGCTGTTAGCAAAGCC
Authenticity test: The plasmid still needs to be subjected to the authenticity test.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Prof. Dr G. Cornelis(1). It was constructed by Dr J. Mota(2).
(1) Research Unit in Microorganism Biology, University of Namur, Namur, Belgium
(2) Biozentrum, University of Basel, Switzerland
Plasmid reference: Mota et al., Science 307 (2005), 1278 [PMID: 15731447]
Restricted distribution: - BCCM MTA
Distributed as: active culture or plasmid DNA
Host for distribution: Escherichia coli K12 LK111
Host reference: Zabeau et al., EMBO J. 1 (1982), 1217-1224 [PMID: 6327257]
Cultivation medium: LB-Lennox + kanamycin (50 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Cultivation remark: -
Other culture collection numbers: -

Refer in your Materials and Methods:

pLJM34 (LMBP 9310) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr G. Cornelis and was published in Mota et al., 2005.

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search