GREAT AT SMALL THINGS

2

GeneCorner plasmid details

Last data update: 24 January 2024 16:39 CET

Plasmid name: pSP64GN (LMBP 1747)

Add to cart

New search Print data sheet
Price category: Cat. 1 (cf. price list)
Status: GeneCorner non-core plasmid
Depositor's sequence: psp64gn.gb
Sequence
analysis results
Genecorner:

-

Cloned DNA: -
Promoter: Phage SP6 promoter
Escherichia coli lac operon promoter
Ribosome
binding site:
Ribosome binding site (RBS) of the Escherichia coli lac Z gene (lacZ)
Terminator: -
Selection marker: Ampicillin (amp)
Replicon: Escherichia coli plasmid pMB1 origin
Host range: Escherichia coli
Parental clone: pSP64T
Further information: This plasmid was derived from pSP64T by ligation of the oligonucleotide 'TCCTGCAGCGGCCGCTCGAGG' between the filled-in (Klenow DNA polymerase) BglII site.
When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide.
Other name of the plasmid is pSP64TN.
EMBL Accession number: -
Latest sequence update: 06/05/1992
Sequence detail:
Nucleotide sequence around the BglII and the BstEII site:

    *                                  +
5' GGCAGATCTCCTGCAGCGGCCGCTCGAGGGATCTGGGTTACCACT 3'
      BglII  PstI NotI   AvaI         BstEII
                   XmaIII
                         XhoI

*: End of the 5' untranslated region of the X.laevis ß-globin gene.
+: Start of the 3' untranslated region of the X.laevis ß-globin gene.
Authenticity test: The plasmid still needs to be subjected to the authenticity test.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by L. Stuyver(1) and Prof. Dr R. Contreras(1).
(1) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium
Plasmid reference: -
Related plasmid reference: Krieg et al., Nucleic Acids Res. 12 (1984), 7057-7070 [PMID: 6207484]
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 MC1061
Host reference: Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493]
Related host reference: Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111]
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Other culture collection numbers: -

Refer in your Materials and Methods:

pSP64GN (LMBP 1747) is available at BCCM/GeneCorner. This plasmid was deposited by L. Stuyver and Prof. Dr R. Contreras.

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search