Last data update: 24 January 2024 16:39 CET
Plasmid name: pSP64GN (LMBP 1747)
New search | Print data sheet |
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner non-core plasmid |
Depositor's sequence: | psp64gn.gb |
Sequence analysis results Genecorner: |
- |
Cloned DNA: |
- |
Promoter: | Phage SP6 promoter Escherichia coli lac operon promoter |
Ribosome binding site: |
Ribosome binding site (RBS) of the Escherichia coli lac Z gene (lacZ) |
Terminator: | - |
Selection marker: | Ampicillin (amp) |
Replicon: | Escherichia coli plasmid pMB1 origin |
Host range: | Escherichia coli |
Parental clone: | pSP64T |
Further information: | This plasmid was derived from pSP64T by ligation of the oligonucleotide 'TCCTGCAGCGGCCGCTCGAGG' between the filled-in (Klenow DNA polymerase) BglII site. When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide. Other name of the plasmid is pSP64TN. |
EMBL Accession number: | - |
Latest sequence update: | 06/05/1992 |
Sequence detail: | Nucleotide sequence around the BglII and the BstEII site: * + 5' GGCAGATCTCCTGCAGCGGCCGCTCGAGGGATCTGGGTTACCACT 3' BglII PstI NotI AvaI BstEII XmaIII XhoI *: End of the 5' untranslated region of the X.laevis ß-globin gene. +: Start of the 3' untranslated region of the X.laevis ß-globin gene. |
Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | This plasmid was deposited by L. Stuyver(1) and Prof. Dr R. Contreras(1). (1) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
Plasmid reference: | - |
Related plasmid reference: | Krieg et al., Nucleic Acids Res. 12 (1984), 7057-7070 [PMID: 6207484] |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 MC1061 |
Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
Cultivation temperature: | 37°C |
Biosafety level: | L1 |
Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pSP64GN (LMBP 1747) is available at BCCM/GeneCorner. This plasmid was deposited by L. Stuyver and Prof. Dr R. Contreras. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.