Last data update: 24 January 2024 16:39 CET
Plasmid name: pSV-Sport-di-RF-HIF-3UTRHIF (LMBP 5211)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner core plasmid |
| GeneCorner sequence: |
p5211.gb
(View with Genome Compiler) p5211.txt p5211.pdf |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Photinus pyralis (firefly) luciferase gene (LUC); mutated coding region (LUCm; luc(+)) Renilla reniformis luciferase gene (rLUC) |
| Promoter: | Phage SP6 promoter Phage T7 gene 10 promoter (T7g10) Escherichia coli lac operon promoter; mutant (lacUV5) Simian virus 40 early promoter (SV40 early) |
| Ribosome binding site: |
Internal ribosome entry site (IRES) of the mouse hypoxia-inducible factor-1 α subunit (HIF-1α) |
| Terminator: | Simian virus 40 polyadenylation signal (SV40 polyA) |
| Selection marker: | Ampicillin (amp) |
| Replicon: | Escherichia coli plasmid pMB1 origin Simian virus 40 bidirectional origin (SV40) |
| Host range: | Escherichia coli Mammalian cells; SV40 permissive cells |
| Parental clone: | pSV-Sport-di-RF-HIF |
| Further information: | The 3' UTR of the mouse hypoxia-inducible factor-1 α subunit (HIF-1α) was generated by nested PCR and cloned as an EcoRI fragment in the EcoRI opened pSV-Sport-di-RF-HIF vector. When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide. The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT726970.1. The nucleotide sequence of the mouse HIF-1α 5' UTR corresponds with the EMBL Nucleotide Sequence Database accession number Y13656.1. The nucleotide sequence of the mouse HIF-1α 3' UTR was obtained from Genbank (Accession number NM_010431.1). Other name of the plasmid is Di-HIF-3UTRHIF. |
| EMBL Accession number: | Y13656.1, view at EMBL, GenBank, DDBJ NM_010431.1, view at GenBank LT726970.1, view at EMBL, GenBank, DDBJ |
| Latest sequence update: | 26/01/2007 |
| Sequence detail: | The primers used in PCR to amplify the HIF-1alpha 3' UTR were:
forward: 5' CCGGAATTCTGAGCGTTTCCTAATCTCATTCCT 3'
EcoRI
reverse: 5' CCGGAATTCTGGTCCACAGAAGATGTTT 3'
EcoRI |
| Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: EcoRI, HindIII, KpnI, NcoI/XbaI and PaeI. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Dr B. Schepens(1) (2) and Prof. Dr R. Beyaert(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | - |
| Related plasmid reference: | Sherf et al., Promega Notes Magazine 49 (1994), 14-21 |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 MC1061 |
| Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
| Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Cultivation remark: | - |
| Other culture collection numbers: | - |
| Related website: | http://www.iresite.org/IRESite_web.php?page=view&entry_id=1 |
Refer in your Materials and Methods: |
pSV-Sport-di-RF-HIF-3UTRHIF (LMBP 5211) is available at BCCM/GeneCorner. This plasmid was deposited by Dr B. Schepens and Prof. Dr R. Beyaert . |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.