GREAT AT SMALL THINGS

1

GeneCorner plasmid details

Last data update: 24 January 2024 16:39 CET

Plasmid name: pSV-Sport-di-RF-UNR(1-334) (LMBP 5257)

Add to cart

New search Print data sheet
Price category: Cat. 1 (cf. price list)
Status: GeneCorner core plasmid
GeneCorner sequence: p5257.gb (View with Genome Compiler)
p5257.txt
p5257.pdf
Sequence
analysis results
Genecorner:

-

Cloned DNA: Photinus pyralis (firefly) luciferase gene (LUC); mutated coding region (LUCm; luc(+))
Renilla reniformis luciferase gene (rLUC)
Promoter: Phage SP6 promoter
Phage T7 gene 10 promoter (T7g10)
Escherichia coli lac operon promoter; mutant (lacUV5)
Simian virus 40 early promoter (SV40 early)
Ribosome
binding site:
Internal ribosome entry site (IRES) of the human upstream of N-ras (UNR, CSDE1) isoform 1; deletion mutant (fragment 1-334)
Terminator: Simian virus 40 polyadenylation signal (SV40 polyA)
Selection marker: Ampicillin (amp)
Replicon: Escherichia coli plasmid pMB1 origin
Simian virus 40 bidirectional origin (SV40)
Host range: Escherichia coli
Mammalian cells; SV40 permissive cells
Parental clone: pSV-Sport-Rluc; pUC19-UNR(1-334)-Fluc
Further information: The construction of the plasmid is described in Cornelis et al. (2005).
pSV-Sport-di-RF-UNR(1-334) is a dicistronic expression vector with a deletion mutant (fragment 1-334) of the internal ribosome entry site (IRES) of the human upstream of N-ras (UNR) isoform 1 cloned in the intercistronic region between the upstream rLUC and downstream LUCm coding sequences. The IRES can drive translation of the downstream LUCm sequence independently of the 5'-cap structure bound to the 5'-end of the mRNA molecule.
This deletion mutant lacks the second pyrimidine-rich sequence in the UNR 5' UTR RNA and strongly reduces its binding to the polypyrimidine tract binding protein (PTB).
When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide.
The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT726987.1.
The nucleotide sequence of the 5' UTR of the human UNR isoform 1 was obtained from Genbank (Accession number NM_001007553.1).
Name mentioned in Cornelis et al. (2005) is Di-pRF-UNR(1-334).
Other name of the plasmid is di-pSVSportUNR(1-334).
EMBL Accession number: NM_001007553.1, view at GenBank
LT726987.1, view at EMBL, GenBank, DDBJ
Latest sequence update: 30/01/2007
Sequence detail:
The primers used in PCR to amplify the hUNR(1-334) fragment were:

forward: 5' CTAGTCTAGATGCTGCTTATGGCGGCGCTGGAGAGGG 3' Primer A *
                XbaI

reverse: 5' CATGCCATGGTGATCTACCAAGCTAATAAAGAATACAAC 3' Primer F *
                NcoI

* Cornelis et al., Nucl. Acids Res. 33 (2005), 3095-3108
Authenticity test: Restriction enzyme pattern analysed at GeneCorner: AflIII, BanII, HindIII and NcoI/XbaI .
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Y. Bruynooghe(1) (2) and Prof. Dr R. Beyaert(1) (2).
(1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium
(2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium
Plasmid reference: Cornelis et al., Nucleic Acids Res. 33 (2005), 3095-3108 [PMID: 15928332]
Related plasmid reference: Sherf et al., Promega Notes Magazine 49 (1994), 14-21
Schepens et al., EMBO J. 26 (2007), 158-169 [PMID: 17159903]
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 MC1061
Host reference: Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493]
Related host reference: Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111]
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Cultivation remark: -
Other culture collection numbers: -
Related website: http://www.iresite.org/IRESite_web.php?page=view&entry_id=81

Refer in your Materials and Methods:

pSV-Sport-di-RF-UNR(1-334) (LMBP 5257) is available at BCCM/GeneCorner. This plasmid was deposited by Y. Bruynooghe and Prof. Dr R. Beyaert and was published in Cornelis et al., 2005.

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search