Last data update: 24 January 2024 16:39 CET
Plasmid name: pSV-Sport-di-RF-cMYC (LMBP 5251)
New search | Print data sheet |
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner core plasmid |
GeneCorner sequence: |
p5251.gb
(View with Genome Compiler) p5251.txt p5251.pdf |
Sequence analysis results Genecorner: |
- |
Cloned DNA: |
Renilla reniformis luciferase gene (rLUC) Photinus pyralis (firefly) luciferase gene (LUC); mutated coding region (LUCm; luc(+)) |
Promoter: | Phage SP6 promoter Phage T7 gene 10 promoter (T7g10) Escherichia coli lac operon promoter; mutant (lacUV5) Simian virus 40 early promoter (SV40 early) |
Ribosome binding site: |
Internal ribosome entry site (IRES) of the human v-myc myelocytomatosis viral oncogene homolog (avian) (cMYC, c-Myc, MYC) |
Terminator: | Simian virus 40 polyadenylation signal (SV40 polyA) |
Selection marker: | Ampicillin (amp) |
Replicon: | Escherichia coli plasmid pMB1 origin Simian virus 40 bidirectional origin (SV40) |
Host range: | Escherichia coli Mammalian cells; SV40 permissive cells |
Parental clone: | pSV-Sport-Rluc; pUC19-cMYC-Fluc |
Further information: | The construction of the plasmid is described in Cornelis et al. (2005). pSV-Sport-di-RF-cMYC is a dicistronic expression vector with the cMYC IRES cloned in the intercistronic region between the upstream rLUC and downstream LUCm coding sequences. The IRES can drive translation of the downstream LUCm sequence independently of the 5'-cap structure bound to the 5'-end of the mRNA molecule. When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide. The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT726983.1. The nucleotide sequence of the 5' UTR of the human v-myc myelocytomatosis viral oncogene homolog corresponds with the EMBL Nucleotide Sequence Database accession number BC000917.2. Name mentioned in Cornelis et al. (2005) is Di-pRF-cMYC. |
EMBL Accession number: | BC000917.2, view at EMBL, GenBank, DDBJ LT726983.1, view at EMBL, GenBank, DDBJ |
Latest sequence update: | 05/02/2007 |
Sequence detail: | The primers used in PCR to amplify the cMYC IRES were: forward: 5' CATGTCTAGATAATTCCAGCGAGAGGCAGAGGGAGCG 3' Primer C * XbaI reverse: 5' CATGCCATGGTCGCGGGAGGCTGCTGGTTTTCCAC 3' Primer D * NcoI *: Cornelis et al., Nucl. Acids Res. 33 (2005), 3095-3108 |
Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: DraI, NcoI/XbaI and PvuII. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | This plasmid was deposited by Y. Bruynooghe(1) (2) and Prof. Dr R. Beyaert(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
Plasmid reference: | Cornelis et al., Nucleic Acids Res. 33 (2005), 3095-3108 [PMID: 15928332] |
Related plasmid reference: | Sherf et al., Promega Notes Magazine 49 (1994), 14-21 |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 MC1061 |
Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
Cultivation temperature: | 37°C |
Biosafety level: | L1 |
Cultivation remark: | - |
Other culture collection numbers: | - |
Related website: | http://www.iresite.org/IRESite_web.php?page=view&entry_id=35 |
Refer in your Materials and Methods: |
pSV-Sport-di-RF-cMYC (LMBP 5251) is available at BCCM/GeneCorner. This plasmid was deposited by Y. Bruynooghe and Prof. Dr R. Beyaert and was published in Cornelis et al., 2005. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.