Last data update: 24 January 2024 16:39 CET
Plasmid name: pSV2L5m (LMBP 3325)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner non-core plasmid |
| Depositor's sequence: | psv2l5m.gb |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Photinus pyralis (firefly) luciferase gene (LUC); mutated hybrid (genomic-cDNA) sequence |
| Promoter: | - |
| Ribosome binding site: |
- |
| Terminator: | Simian virus 40 polyadenylation signal (SV40 polyA) |
| Selection marker: | Ampicillin (amp) |
| Replicon: | Escherichia coli plasmid pMB1 origin |
| Host range: | Escherichia coli |
| Parental clone: | pSV2L5 |
| Further information: | This plasmid was derived from pSV2L5 by site-specific mutagenesis according to Morinaga et al., Biotechnology 2 (1984), 636-639, using the synthetic oligonucleotide. As a result, the start codon of the luciferase gene was removed and a PstI site was created at that position. After PstI digestion and blunting the 3' sticky ends, the mutated full-length and intronless hybrid genomic-cDNA luciferase gene from the firefly Photinus pyralis can be cloned into plasmids carrying an ATG start codon accessible for blunt-end ligation. pSV2L5m contains the SV40 small t-antigen splicing signal. |
| EMBL Accession number: | - |
| Latest sequence update: | 20/06/1996 |
| Sequence detail: | Nucleotide sequence at the 5' end of the luciferase gene:
5' UTR -> 1 2 3
Wild type LUC gene: 5' GTTGGTAAA ATG.GAA.GAC. 3'
5' UTR -> 2 3
Mutated LUC gene: 5' GTTGGTACT GCA.GAA.GAC. 3'
** ***
PstI
*: Mutated nucleotide.
Punctuation indicates reading frame.
Sequence of the synthetic oligonucleotide:
5' GGCGTCTTCTGCAGTACCAACAGTACCGG 3' |
| Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by K. Keymeulen(1) (2) and Prof. Dr E. Remaut(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | - |
| Related plasmid reference: | Morinaga et al., Biotechnology 2 (1984), 636-639 |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 WK6mutS(λ) |
| Host reference: | Zell et al., EMBO J. 6 (1987), 1809-1815 [PMID: 3038536] |
| Related host reference: | Stanssens et al., Nucleic Acids Res. 17 (1989), 4441-4454 [PMID: 2501754] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Cultivation remark: | - |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pSV2L5m (LMBP 3325) is available at BCCM/GeneCorner. This plasmid was deposited by K. Keymeulen and Prof. Dr E. Remaut . |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.