Last data update: 24 January 2024 16:39 CET
Plasmid name: pSV52 (LMBP 1830)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner non-core plasmid |
| Depositor's sequence: | psv52.gb |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
- |
| Promoter: | Simian virus 40 early promoter (SV40 early) Simian virus 40 late promoter (SV40 late) |
| Ribosome binding site: |
- |
| Terminator: | Simian virus 40 polyadenylation signal (SV40 polyA) |
| Selection marker: | Ampicillin (amp) |
| Replicon: | Escherichia coli plasmid pMB1 origin Simian virus 40 bidirectional origin (SV40) |
| Host range: | Escherichia coli Mammalian cells; SV40 permissive cells |
| Parental clone: | pSV51 |
| Further information: | This plasmid was derived from pSV51 by deletion of the SalI fragment (containing the lac operator and the fd terminator), creating a unique SalI site. SV40 DNA information starts at the HpaII site which was fused to the ClaI site of pBR322. This plasmid is a basic vector for gene expression under direction of the SV40 late promoter (requires permissive cells, i.e. AGMK derivatives). An intron is excised from the 5' UTR of the major SV40 late transcripts. The most important transcription initiation site is located at nucleotide position 4838 (cfr. L325 in SV410). The transcription termination/polyadenylation site of SV40 (polyA on the circular map) is used. This polyA signal contains the 3' end of the VP1 coding sequence, from the BamHI site (position 3078) until position 3023 (TGA). The SV40 late transcripts have multiple cap sites. The first early region of this vector is intact (it codes for the large T-antigen), so that the plasmid can replicate in all SV40 permissive cells. Since 39% of the SV40 genome is duplicated (early region), one should be aware of the possibility of deletions due to homologous recombination. Other name of the plasmid is pSV5291deltalacS. |
| EMBL Accession number: | - |
| Latest sequence update: | 04/04/1989 |
| Sequence detail: | Nucleotide sequence of the linker after deletion of the SalI fragment:
5' GGATCCGGCTCTAGAGGGTCGACCCTCTAGAGGCTGCAGCCGACCCCGGATCCGGA 3'
BamHI XbaI SalI XbaI PstI BamHI
BspMII |
| Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by G. Maertens(1) and Prof. Dr W. Min Jou(1). (1) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | - |
| Related plasmid reference: | Huylebroeck et al., Gene 66 (1988), 163-181 [PMID: 2844629] |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 MC1061 |
| Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
| Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pSV52 (LMBP 1830) is available at BCCM/GeneCorner. This plasmid was deposited by G. Maertens and Prof. Dr W. Min Jou. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.