Last data update: 24 January 2024 16:39 CET
Plasmid name: pSV71 (LMBP 2517)
New search | Print data sheet |
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner non-core plasmid |
Depositor's sequence: | psv71.gb |
Sequence analysis results Genecorner: |
- |
Cloned DNA: |
- |
Promoter: | Simian virus 40 late promoter (SV40 late) Simian virus 40 early promoter (SV40 early) |
Ribosome binding site: |
- |
Terminator: | Simian virus 40 polyadenylation signal (SV40 polyA) |
Selection marker: | Chloramphenicol (cam) |
Replicon: | Escherichia coli plasmid pMB1 origin Simian virus 40 bidirectional origin (SV40) |
Host range: | Escherichia coli; preferably recombination-deficient strains Mammalian cells; SV40 permissive cells |
Parental clone: | pSV5; pMc59 |
Further information: | The plasmid was constructed by substituting the ampicillin resistance gene (amp) containing EcoRI-RspXI fragment of pSV51, by the chloramphenicol resistance gene (cam) containing EcoRI-RspXI fragment of pMc59. Therefore, the following three fragments were ligated: the cam containing EcoRI-RspXI fragment of pMc59, the EcoRI-XbaI (nucleotide position 3087) fragment from pSV51, and the XbaI (nucleotide position 3636) - RspXI (nucleotide position 8024) fragment from pSV51. Because of this cloning strategy, the multiple cloning site of pSV71 was reduced compared to the one in pSV51. |
EMBL Accession number: | - |
Latest sequence update: | 07/05/1991 |
Sequence detail: | Nucleotide sequence of the reduced multicloning site: 5' ATGTCT GGATCCGGCTCTAGAGGCTGCAGCCGACCCCGGATCCGGA 3' * BamHI XbaI PstI BamHI BspMII * : End of the polyA signal of the SV40 early region. |
Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | This plasmid was deposited by K. De Sutter(1) and Prof. Dr W. Fiers(1). (1) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
Plasmid reference: | - |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 DH5α |
Host reference: | Focus 8 (1986), 9 |
Related host reference: | Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660] Rodriguez-Quinones et al., Focus 15 (1993), 110-112 Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791] [DOI: 10.1016/s0022-2836(83)80284-8] Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187] Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051] |
Cultivation medium: | LB-Lennox + chloramphenicol (25 μg/ml) |
Cultivation temperature: | 37°C |
Biosafety level: | L1 |
Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pSV71 (LMBP 2517) is available at BCCM/GeneCorner. This plasmid was deposited by K. De Sutter and Prof. Dr W. Fiers. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.