GREAT AT SMALL THINGS

4

GeneCorner plasmid details

Last data update: 24 January 2024 16:39 CET

Plasmid name: pSV71 (LMBP 2517)

Add to cart

New search Print data sheet
Price category: Cat. 1 (cf. price list)
Status: GeneCorner non-core plasmid
Depositor's sequence: psv71.gb
Sequence
analysis results
Genecorner:

-

Cloned DNA: -
Promoter: Simian virus 40 late promoter (SV40 late)
Simian virus 40 early promoter (SV40 early)
Ribosome
binding site:
-
Terminator: Simian virus 40 polyadenylation signal (SV40 polyA)
Selection marker: Chloramphenicol (cam)
Replicon: Escherichia coli plasmid pMB1 origin
Simian virus 40 bidirectional origin (SV40)
Host range: Escherichia coli; preferably recombination-deficient strains
Mammalian cells; SV40 permissive cells
Parental clone: pSV5; pMc59
Further information: The plasmid was constructed by substituting the ampicillin resistance gene (amp) containing EcoRI-RspXI fragment of pSV51, by the chloramphenicol resistance gene (cam) containing EcoRI-RspXI fragment of pMc59. Therefore, the following three fragments were ligated: the cam containing EcoRI-RspXI fragment of pMc59, the EcoRI-XbaI (nucleotide position 3087) fragment from pSV51, and the XbaI (nucleotide position 3636) - RspXI (nucleotide position 8024) fragment from pSV51.
Because of this cloning strategy, the multiple cloning site of pSV71 was reduced compared to the one in pSV51.
EMBL Accession number: -
Latest sequence update: 07/05/1991
Sequence detail:
Nucleotide sequence of the reduced multicloning site:

5' ATGTCT GGATCCGGCTCTAGAGGCTGCAGCCGACCCCGGATCCGGA 3'
        * BamHI    XbaI    PstI          BamHI
                                            BspMII

* : End of the polyA signal of the SV40 early region.
Authenticity test: The plasmid still needs to be subjected to the authenticity test.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by K. De Sutter(1) and Prof. Dr W. Fiers(1).
(1) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium
Plasmid reference: -
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 DH5α
Host reference: Focus 8 (1986), 9
Related host reference: Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660]
Rodriguez-Quinones et al., Focus 15 (1993), 110-112
Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791] [DOI: 10.1016/s0022-2836(83)80284-8]
Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187]
Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051]
Cultivation medium: LB-Lennox + chloramphenicol (25 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Other culture collection numbers: -

Refer in your Materials and Methods:

pSV71 (LMBP 2517) is available at BCCM/GeneCorner. This plasmid was deposited by K. De Sutter and Prof. Dr W. Fiers.

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search