Last data update: 24 January 2024 16:39 CET
Plasmid name: pVL941 (LMBP 2306)
New search | Print data sheet |
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner core plasmid |
GeneCorner sequence: |
pvl941.gb
(View with Genome Compiler) pvl941.pdf |
Sequence analysis results Genecorner: |
- |
Cloned DNA: |
- |
Promoter: | Escherichia coli lac operon promoter Autographa californica nuclear polyhedrosis virus (AcNPV) polyhedrin promoter (PH) |
Ribosome binding site: |
- |
Terminator: | - |
Selection marker: | Ampicillin (amp) |
Replicon: | Escherichia coli plasmid pMB1 origin |
Host range: | Escherichia coli |
Parental clone: | pAc311 |
Further information: | This plasmid was constructed by cloning the Autographa californica nuclear polyhedrosis virus (AcNPV) EcoRI-I fragment into the unique EcoRI expression site of the pUC8 multilinker region. All the sites of this multilinker, except HindIII at nucleotide position 399, have been removed. The polyhedrin gene (APH) was then inactivated by site-directed mutagenesis of the ATG start codon to ATT and by deletion of the region +36 to +175 (relative to the ATG start codon), where a unique BamHI restriction site was inserted for expression of foreign genes. The BamHI site at position 6825 (ORF8) of AcNPV has been removed. This plasmid contains a strain E2 virus fragment, but in absence of sequence information of E2 the sequence of virus strain C6 was used for the reconstruction of the plasmid sequence. When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide. The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727492.1. Some of the unique restriction sites mentioned are possibly not unique, because the nucleotide sequence is not completely known. Experimentally verified restriction sites in the AcNPV nucleotide sequence are: HindIII, BstEII, PvuII, XhoI, SalI, EcoRV, BamHI, KpnI and EcoRI. There are no cleavage sites for BglII, PstI, SmaI, SacI and XbaI. |
EMBL Accession number: | LT727492.1, view at EMBL, GenBank, DDBJ |
Latest sequence update: | 02/02/1993 |
Sequence detail: | Nucleotide sequence around the BamHI expression site: +1 +35 +176 | * | | 5' TATAAAT ATTCCGGATTATTCATACCGTCCCACCATCGGGCG CGGATC CTTCCT 3' SspI BspMII BamHI *: Mutated nucleotide of the ATG start codon. |
Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: HindIII, KpnI and PvuI. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | This plasmid was deposited by Dr M. Summers(1). (1) Texas A&M University Systems, Texas |
Plasmid reference: | Luckow et al., Virology 170 (1989), 31-39 [PMID: 2497580] |
Related plasmid reference: | Possee et al., Virology 185 (1991), 229-241 [PMID: 1926775] Hooft Van Iddekinge et al., Virology 131 (1983), 561-565 [PMID: 18639177] |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 MC1061 |
Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
Cultivation temperature: | 28°C |
Biosafety level: | L1 |
Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pVL941 (LMBP 2306) is available at BCCM/GeneCorner. This plasmid was deposited by Dr M. Summers and was published in Luckow et al., 1989. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.