Last data update: 24 January 2024 16:39 CET
Plasmid name: pcDNA3-RF-PITSLRE-Di-4mB (LMBP 6108)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner core plasmid |
| GeneCorner sequence: |
p6108.gb
(View with Genome Compiler) p6108.txt p6108.pdf |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Photinus pyralis (firefly) luciferase gene (LUC); mutated coding region (LUCm; luc(+)) Renilla reniformis luciferase gene (rLUC) |
| Promoter: | Human cytomegalovirus immediate early promoter (CMV-IE) and enhancer Phage SP6 promoter Phage T7 gene 10 promoter (T7g10) Simian virus 40 early promoter (SV40 early) Escherichia coli lac operon promoter |
| Ribosome binding site: |
Internal ribosome entry site (IRES), i.e. Di-4 fragment, of the human PITSLRE kinase gene (CDC2L2, CDK11, p110 PITSLRE; expressing the β SV3 isoform); mutant B |
| Terminator: | Bovine growth hormone polyadenylation signal (BGH polyA) Simian virus 40 polyadenylation signal (SV40 polyA) |
| Selection marker: | Ampicillin (amp) Neomycin (neo; G418) |
| Replicon: | Escherichia coli plasmid pMB1 origin Phage f1 origin Simian virus 40 bidirectional origin (SV40) |
| Host range: | Escherichia coli Mammalian cells; SV40 permissive cells |
| Parental clone: | pUC19-IRES-lacZ; pBluescript-fluc; pcDNA3 |
| Further information: | The plasmid was constructed as follows: 1) the PITSLRE-Di-4mB PCR fragment, digested with XbaI and NcoI, was cloned together with the KpnI-XbaI fragment from pGL3-rluc, containing the R. reniformis rLUC coding sequence, into the KpnI-NcoI linearized pUC19-IRES-lacZ vector; 2) the rLUC-PITSLRE-Di-4mB insert, recovered as a KpnI-NcoI fragment from the pUC19-IRES-lacZ derivative, was cloned together with the NcoI-EcoRI fragment from pBluescript-fluc, containing the mutated coding sequence of the firefly luciferase gene (LUCm; luc(+)), into the KpnI-EcoRI linearized pcDNA3 vector. pcDNA3-RF-PITSLRE-Di-4mB is a dicistronic expression vector with a truncated internal ribosome entry site (IRES) of the human CDC2L2 gene, i.e. mutant B of the Di-4 fragment of p110 PITSLRE, in the intercistronic region between upstream rLUC and downstream LUCm coding sequences. The IRES activity is strongly impaired by Di-4mB but it still permits the translation of the two open reading frames from one messenger RNA. Unlike pcDNA3, pcDNA3-RF-PITSLRE-Di-4mB has not been shown to provide resistance to kanamycin. As compared to mutants A, D, E and F, this plasmid is the best alternative for Di-2, the negative control vector described in Tinton et al. (2005) (Bert Schepens; personal communication). The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT726822.1. The nucleotide sequence of the PITSLRE-Di-4mB IRES corresponds with the EMBL Nucleotide Sequence Database accession number AF043239.1. The presence of a second enhancer in the SV40 early promoter was shown by sequence analysis at LMBP. Other name of the plasmid is pcdna3 RLuc-PIT D4-mutB. |
| EMBL Accession number: | AF043239.1, view at EMBL, GenBank, DDBJ LT726822.1, view at EMBL, GenBank, DDBJ |
| Latest sequence update: | 03/02/2012 |
| Sequence detail: | Primers used to amplify mutant B of the Di-4 fragment of p110 PITSLRE:
|-> Di-4
forward primer: 5' CTAGTCTAG|ACATCACCGAACGATGAGAGAGG 3'
XbaI
|<- Di-4
reverse primer: 5' CATGCCATGGA|GAACCTGAGCCTGATTCTGCTGACGA 3'
NcoI |
| Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: AvaII, NdeI, NcoI and NcoI/XbaI. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Prof. Dr R. Beyaert(1) (2). It was constructed by Dr S. Tinton(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | Tinton et al., Biochem. J. 385 (2005), 155-163 [PMID: 15330758] |
| Related plasmid reference: | Sherf et al., Promega Notes Magazine 49 (1994), 14-21 Schepens et al., EMBO J. 26 (2007), 158-169 [PMID: 17159903] |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 DH5α |
| Host reference: | Focus 8 (1986), 9 |
| Related host reference: | Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660] Rodriguez-Quinones et al., Focus 15 (1993), 110-112 Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791] [DOI: 10.1016/s0022-2836(83)80284-8] Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187] Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Cultivation remark: | - |
| Other culture collection numbers: | - |
| Related website: | http://www.iresite.org/IRESite_web.php?page=view&entry_id=436 |
Refer in your Materials and Methods: |
pcDNA3-RF-PITSLRE-Di-4mB (LMBP 6108) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr R. Beyaert and was published in Tinton et al., 2005. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.