Last data update: 19 January 2021 04:19 CET
Plasmid name: pAS2-mABIN-1 (LMBP 5392)
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner core plasmid |
GeneCorner sequence: |
p5392.gb
(View with Genome Compiler) p5392.txt p5392.pdf |
Sequence analysis results Genecorner: |
- |
Cloned DNA: |
Mouse A20-binding inhibitor of NF-κB activation 1 cDNA (ABIN-1, TNIP1) Saccharomyces cerevisiae GAL4 DNA-binding domain (GALbd) Influenza HA epitope encoding the haemagglutinin tagging peptide; N-terminal |
Promoter: | Saccharomyces cerevisiae alcohol dehydrogenase promoter (ADH1) Escherichia coli lac operon promoter |
Ribosome binding site: |
- |
Terminator: | Saccharomyces cerevisiae alcohol dehydrogenase terminator (ADH1) Saccharomyces cerevisiae iso-1-cytochrome C terminator (CYC1) Saccharomyces cerevisiae 2 micron plasmid (2μ) FLP terminator |
Selection marker: | Ampicillin (amp) Cycloheximide (CYH2) TRP1; auxotrophic |
Replicon: | Escherichia coli plasmid pMB1 origin Phage f1 origin Saccharomyces cerevisiae 2 micron plasmid origin (2μ); incl. region conferring stability (STB) |
Host range: | Escherichia coli Saccharomyces cerevisiae; trp1(-) |
Parental clone: | pAS2 |
Further information: | The plasmid was constructed by ligating the following fragments: 1) the 6699 bp SmaI-BsmI fragment of pAS2; 2) the 1699 bp BsmI-EaeI fragment of pAS2; 3) the 2126 bp NotI-SmaI PCR fragment, containing the mABIN-1 coding sequence. As a result, the mABIN-1 coding sequence is fused in phase to the N-terminal HA epitope and the S. cerevisiae GALbd domain. The S. cerevisiae GALbd is composed of the first 147 codons from GAL4, containing the nuclear localization signal. The GALbd-HA-mABIN-1 fusion protein can be used as a bait protein in two-hybrid screening. pAS2-mABIN-1 carries the S. cerevisiae tryptophan 1 coding sequence (TRP1) and the CYH2 sequence encoding ribosomal protein L29 for dominant cycloheximide sensitivity which facilitates the elimination of false positives. When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide. The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT726885.1. The nucleotide sequence of the pAS2 vector corresponds with the EMBL Nucleotide Sequence Database accession number U30496.1, but adapted as follows: 1) the 'N' nucleotide was removed, restoring the coding sequence of cycloheximide; 2) the sequence GATTTC between GALbd and the HA epitope was replaced by GAATTC, an EcoRI site that has been experimentally confirmed in pAS2; 3) the sequence TTCGAA (Csp45I site) in the ADH1 promoter was replaced by TCGAAG, eliminating the Csp45I site that could not be experimentally confirmed in pAS2. The nucleotide sequence of the mABIN-1 cDNA corresponds with the EMBL Nucleotide Sequence Database accession number AJ242778.1. Other name of the plasmid is pAS2-mABIN-1(1). |
EMBL Accession number: | U30496.1, view at EMBL, GenBank, DDBJ AJ242778.1, view at EMBL, GenBank, DDBJ LT726885.1, view at EMBL, GenBank, DDBJ |
Latest sequence update: | 20/03/2007 |
Sequence detail: | Primers used to amplify mABIN-1: 1 5 forward: 5' ATAAGAATGCGGCCGCC.ATG.GAA.GGG.AGA.GGA.CC 3' NotI *** Glu Gly Arg Gly Pro reverse: 5' TCCCCCGGGTCTTGTCAACAGTTCGAGG 3' SmaI ***: start codon. Punctuation indicates reading frame. |
Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: BglI/EcoRI, Bsp119I/NdeI, Eco32I/PaeI, NheI/SmaI, Psp5II/SspI and SacI. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | This plasmid was deposited by Dr K. Heyninck(1) (2) and Prof. Dr R. Beyaert(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
Plasmid reference: | - |
Related plasmid reference: | Zhou et al., Mol. Pharmacol. 93 (2018), 36-48 [PMID: 29237725] [DOI: 10.1124/mol.117.109009] |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 MC1061 |
Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
Cultivation temperature: | 37°C |
Biosafety level: | L1 |
Cultivation remark: | - |
Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pAS2-mABIN-1 (LMBP 5392) is available at BCCM/GeneCorner. This plasmid was deposited by Dr K. Heyninck and Prof. Dr R. Beyaert . |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.