Last data update: 24 January 2024 16:39 CET
Plasmid name: pSCMF4 (LMBP 1649)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner core plasmid |
| GeneCorner sequence: |
pscmf4.gb
(View with Genome Compiler) pscmf4.pdf |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Saccharomyces cerevisiae α-mating factor 1 gene (MFα1); prepro secretion signal sequence (ppMF) |
| Promoter: | Saccharomyces cerevisiae α-mating factor 1 promoter (MF) Escherichia coli lac operon promoter |
| Ribosome binding site: |
Ribosome binding site (RBS) of the Escherichia coli lac Z gene (lacZ) |
| Terminator: | - |
| Selection marker: | Ampicillin (amp) |
| Replicon: | Escherichia coli plasmid pMB1 origin |
| Host range: | Escherichia coli |
| Parental clone: | pSCMF3; pUC19 |
| Further information: | This plasmid has, as compared to pSCMF3, a polylinker downstream from the StuI site of the prepro secretion signal sequence (ppMF) of the Saccharomyces cerevisiae α-mating factor 1 gene (MFα1). The segment from residue 149 to 401 corresponds in anticlockwise orientation to the 3' end of the lacZα fragment. Attention: the vector part of the plasmid is probably not entirely correct: the restriction sites were not all experimentally verified. When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide. The nucleotide sequence from nucleotide position 1660 to 1360 corresponds with the upstream sequence of the S. cerevisiae α-mating factor 1 (MF) promoter. Other name of the plasmid is pMATA4. |
| EMBL Accession number: | - |
| Latest sequence update: | 16/11/1989 |
| Sequence detail: | Nucleotide sequence at the end of the prepro sequence:
---- ppMF ---->|
80 83| |
5' GTA.TCT.TTG.GAT.AAA.AGG|CCT.CTT.GAAGCTTGCATGCCTGCAGGTCGAC
Val Ser Leu Asp Lys Arg|Pro Ala Glu SphI PstI HindII
*|*** ** HindIII
StuI
TCTAGAGGATCCCCGGGTACCGAGCTCGAATTCACTGGCCGTCGTTTTACAACGTCGT 3'
XbaI BamHI KpnI SacI EcoRI
SmaI HgiJII
AvaI
*: mutated nucleotide
|: Cutting site of the alpha mating factor Kex2 endoprotease. |
| Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: EcoRI, HindIII, SspI and StuI. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by F. Hanssens(1) and Prof. Dr R. Contreras(1). (1) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | - |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 DH5α |
| Host reference: | Focus 8 (1986), 9 |
| Related host reference: | Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660] Rodriguez-Quinones et al., Focus 15 (1993), 110-112 Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791] [DOI: 10.1016/s0022-2836(83)80284-8] Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187] Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 28°C |
| Biosafety level: | L1 |
| Cultivation remark: | - |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pSCMF4 (LMBP 1649) is available at BCCM/GeneCorner. This plasmid was deposited by F. Hanssens and Prof. Dr R. Contreras. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.