Last data update: 24 January 2024 16:39 CET
Plasmid name: pSV-Sport-di-hp-FR-HIF (LMBP 5206)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner core plasmid |
| GeneCorner sequence: |
p5206.gb
(View with Genome Compiler) p5206.txt p5206.pdf |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Photinus pyralis (firefly) luciferase gene (LUC); mutated coding region (LUCm; luc(+)) Renilla reniformis luciferase gene (rLUC) |
| Promoter: | Phage SP6 promoter Phage T7 gene 10 promoter (T7g10) Escherichia coli lac operon promoter; mutant (lacUV5) Simian virus 40 early promoter (SV40 early) |
| Ribosome binding site: |
Internal ribosome entry site (IRES) of the mouse hypoxia-inducible factor-1 α subunit (HIF-1α) |
| Terminator: | Simian virus 40 polyadenylation signal (SV40 polyA) |
| Selection marker: | Ampicillin (amp) |
| Replicon: | Escherichia coli plasmid pMB1 origin Simian virus 40 bidirectional origin (SV40) |
| Host range: | Escherichia coli Mammalian cells; SV40 permissive cells |
| Parental clone: | pSV SPORT 1; pGL3-Basic-hp; pUC18; pSV-Sport-Rluc |
| Further information: | A stem-loop structure was created because the forward PCR primer contains 27 terminal nucleotides that are complementary to a 27 bp sequence upstream of the HindIII site in pGL3-Basic. The plasmid was constructed by two successive three-point ligations as follows: A stable stem-loop or hairpin (hp) structure immediately upstream of the firefly luciferase open reading frame was introduced as follows: (I) a PCR was performed on the pGL3-Basic plasmid; (ii) the resulting amplification product was digested with HindIII-XbaI and subsequently cloned back into pGL3-Basic, generating pGL3-Basic-hp. (i) the PCR amplified HIF-1α IRES fragment was digested with XbaI-NcoI and cloned together with the Renilla luciferase coding region, obtained as an NcoI-EcoRI fragment from pSV-Sport-Rluc, into the XbaI-EcoRI opened pUC18 vector; (ii) the IRES-Renilla luciferase insert was digested with XbaI-EcoRI and ligated to both the stem-loop-containing, mutated firefly luciferase coding region, obtained as a KpnI-XbaI fragment from pGL3-Basic-hp, and the KpnI-EcoRI opened pSV SPORT 1 expression vector. As compared to pSV-Sport-di-FR-HIF, the inverted repeat inserted immediately upstream of the LUCm coding region of this plasmid further confirms the presence of an IRES in the mHIF-1α 5' UTR and excludes a possible contribution from cap-dependent mechanisms. The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT726965.1. The nucleotide sequence of the mouse HIF-1α 5' UTR corresponds with the EMBL Nucleotide Sequence Database accession number Y13656.1. Other name of the plasmid is Di-hp-HIF. |
| EMBL Accession number: | Y13656.1, view at EMBL, GenBank, DDBJ LT726965.1, view at EMBL, GenBank, DDBJ |
| Latest sequence update: | 17/01/2007 |
| Sequence detail: | The primers used in PCR to introduce the stem-loop structure:
forward: 5' CCCAAGCTTACTTAGATCGCAGATCTCGAGCCCGGGAACCATGGAAGACGCCAAAAACATAAAGAAAGG 3'
-------------------------- --> LUCm
HindIII nucleotides complementary
to 27 bp upstream HindIII
in pGL3-Basic
reverse: 5' CCGACTCTAGAATTACACGGCGATCTT 3'
XbaI |
| Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: KpnI, NcoI/XbaI, PaeI and XhoI. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Dr B. Schepens(1) (2) and Prof. Dr R. Beyaert(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | - |
| Related plasmid reference: | Sherf et al., Promega Notes Magazine 49 (1994), 14-21 Cornelis et al., Nucleic Acids Res. 33 (2005), 3095-3108 [PMID: 15928332] |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 MC1061 |
| Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
| Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Cultivation remark: | - |
| Other culture collection numbers: | - |
| Related website: | http://www.iresite.org/IRESite_web.php?page=view&entry_id=1 |
Refer in your Materials and Methods: |
pSV-Sport-di-hp-FR-HIF (LMBP 5206) is available at BCCM/GeneCorner. This plasmid was deposited by Dr B. Schepens and Prof. Dr R. Beyaert . |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.