Last data update: 24 January 2024 16:39 CET
Plasmid name: pSV53 (LMBP 1838)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner non-core plasmid |
| Depositor's sequence: | psv53.gb |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
- |
| Promoter: | Simian virus 40 late promoter (SV40 late) Simian virus 40 early promoter (SV40 early) |
| Ribosome binding site: |
- |
| Terminator: | Simian virus 40 polyadenylation signal (SV40 polyA) |
| Selection marker: | Ampicillin (amp) |
| Replicon: | Escherichia coli plasmid pMB1 origin Simian virus 40 bidirectional origin (SV40) |
| Host range: | Escherichia coli; preferably recombination-deficient strains Mammalian cells; SV40 permissive cells |
| Parental clone: | pSV529 |
| Further information: | pSV53 was derived from pSV529 by inserting a polylinker in the unique BamHI site. |
| EMBL Accession number: | - |
| Latest sequence update: | 16/05/1988 |
| Sequence detail: | Nucleotide sequence around the inserted polylinker:
polylinker
-----------------------------
5' GGATCCGAGCTCCCCGGGGTCGACTCTAGAGATCCGGA 3'
BamHI HgiJII SalI XbaI BspMII
SacI AvaI
SmaI |
| Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by G. Maertens(1) and Prof. Dr W. Min Jou(1). (1) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | Huylebroeck et al., Gene 66 (1988), 163-181 [PMID: 2844629] |
| Related plasmid reference: | Huylebroeck et al., Gene 66 (1988), 163-181 [PMID: 2844629] |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli |
| Host reference: | - |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Cultivation remark: | - |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pSV53 (LMBP 1838) is available at BCCM/GeneCorner. This plasmid was deposited by G. Maertens and Prof. Dr W. Min Jou and was published in Huylebroeck et al., 1988. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.