Last data update: 24 January 2024 16:39 CET
Plasmid name: pUC18Sfi (LMBP 3366)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner core plasmid |
| GeneCorner sequence: |
puc18sfi.gb
(View with Genome Compiler) puc18sfi.pdf |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Escherichia coli lac Z gene (lacZ); α part |
| Promoter: | Escherichia coli lac operon promoter |
| Ribosome binding site: |
Ribosome binding site (RBS) of the Escherichia coli lac Z gene (lacZ) |
| Terminator: | - |
| Selection marker: | Ampicillin (amp) |
| Replicon: | Escherichia coli plasmid pMB1 origin |
| Host range: | Escherichia coli; use strains expressing the lacZ ω fragment (lacZΔM15) for screening |
| Parental clone: | pUC18 |
| Further information: | This plasmid is designed as an insert detection vector using α-complementation. This plasmid is suitable for the expression of fused proteins using the lac promoter and lacZα part. pUC18Sfi differs from pUC18 in the polylinker; the complete polylinker is flanked by two SfiI sites. The exact construction method is not known. pUC18Sfi has no PstI site in the ampicillin resistance gene. When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide. The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727472.1. |
| EMBL Accession number: | LT727472.1, view at EMBL, GenBank, DDBJ |
| Latest sequence update: | 26/09/1996 |
| Sequence detail: | Polylinker sequence of pUC18Sfi:
370 380 390 400 410 420
5' TTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGCCNGGCCGCCTAGGCCNAAGCTTG
SfiI HindIII
SphI
430 440 450 460 470 480
CATGCCTGCAGGTCGACTCTAGAGGATCCCCGGGTACCGAGCTCGAATTCNGGCCGCCTA
Sse8387I AvaI EcoRI SfiI
PstI HindII BamHI
AccI XbaI SmaI SacI ApoI
SalI HgiJII
BspMI KpnI
490 500 510 520 530 540
GGCCNGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCA 3'
<-- *
* : Start of the LacZ alpha (orientation is antisense) |
| Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: HindIII, PvuI and RsaI. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Dr K.N. Timmis(1). (1) GBF, Germany |
| Plasmid reference: | Herrero et al., J. Bacteriol. 172 (1990), 6557-6567 [PMID: 2172216] [DOI: 10.1128/jb.172.11.6557-6567.1990] |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 MC1061 |
| Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
| Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pUC18Sfi (LMBP 3366) is available at BCCM/GeneCorner. This plasmid was deposited by Dr K.N. Timmis and was published in Herrero et al., 1990. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.