GREAT AT SMALL THINGS

0

GeneCorner plasmid details

Last data update: 03 December 2020 04:26 CET

Plasmid name: pCAGGS-E-hUNR (LMBP 6421)

Add to cart

New search

Price category: Cat. 1 (cf. price list)
Status: GeneCorner core plasmid
GeneCorner sequence: p6421.gb (View with Genome Compiler)
p6421.txt
p6421.pdf
Sequence
analysis results
Genecorner:

-

Cloned DNA: Human upstream of N-ras cDNA (UNR, CSDE1); isoform 1
E-tag; N-terminal
Promoter: Chicken β-actin/rabbit β-globin hybrid promoter (AG)
Human cytomegalovirus immediate early promoter (CMV-IE); enhancer only
Escherichia coli lac operon promoter
Ribosome
binding site:
-
Terminator: Rabbit β-globin polyadenylation signal (β-globin polyA)
Simian virus 40 polyadenylation signal (SV40 polyA)
Selection marker: Ampicillin (amp)
Replicon: Escherichia coli plasmid pMB1 origin
Simian virus 40 bidirectional origin (SV40)
Host range: Escherichia coli
Mammalian cells; SV40 permissive cells
Parental clone: pCAGGS
Further information: The plasmid was constructed as follows: 1) the hUNR cDNA was amplified by PCR; 2) the NotI/XhoI digested PCR amplicon was fused to the E-tag of a NotI/XhoI opened pCAGGS-based expression plasmid.
pCAGGS-E-hUNR is useful for highly efficient expression of hUNR under the control of the AG promoter and the hCMV-IE enhancer in various mammalian cells.
When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide.
The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT726829.1.
The nucleotide sequence of the hUNR cDNA corresponds with the Genbank accession number NM_001007553.1 which was adapted according to the reverse primer J described in Schepens et al. (2007).
Other name of the plasmid is pcUNR.
EMBL Accession number: NM_001007553.1, view at GenBank
LT726829.1, view at EMBL, GenBank, DDBJ
Latest sequence update: 15/01/2007
Sequence detail:
The primers used in PCR to amplify hUNR cDNA were:

forward: 5' ATAAGAATGCGGCCGCTATGAGCTTTGATC 3'              Primer I *
                    NotI

reverse: 5' AACCGCTCGAGTTAATCAATGACACCAGCTTGACGGATCTT 3'   Primer J *
                 XhoI     |
                          G according to NM_001007553 (results in same amino acid (Asp))

*: Schepens et al., EMBO J. 26 (2007), 158-169
Authenticity test: Restriction enzyme pattern analysed at GeneCorner: Alw44I/HincII, AlwNI, CaiI, EcoRI, NotI and NotI/XhoI.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Dr B. Schepens(1) (2) and Prof. Dr R. Beyaert(1) (2).
(1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium
(2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium
Plasmid reference: Schepens et al., EMBO J. 26 (2007), 158-169 [PMID: 17159903]
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 MC1061
Host reference: Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493]
Related host reference: Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111]
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Cultivation remark: -
Other culture collection numbers: LMBP 05212

Refer in your Materials and Methods:

pCAGGS-E-hUNR (LMBP 6421) is available at BCCM/GeneCorner. This plasmid was deposited by Dr B. Schepens and Prof. Dr R. Beyaert and was published in Schepens et al., 2007.

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search