Last data update: 20 April 2021 09:48 CEST
Plasmid name: pCAGGS-E-hUNR (LMBP 6421)
New search | Print data sheet |
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner core plasmid |
GeneCorner sequence: |
p6421.gb
(View with Genome Compiler) p6421.txt p6421.pdf |
Sequence analysis results Genecorner: |
- |
Cloned DNA: |
Human upstream of N-ras cDNA (UNR, CSDE1); isoform 1 E-tag; N-terminal |
Promoter: | Chicken β-actin/rabbit β-globin hybrid promoter (AG) Human cytomegalovirus immediate early promoter (CMV-IE); enhancer only Escherichia coli lac operon promoter |
Ribosome binding site: |
- |
Terminator: | Rabbit β-globin polyadenylation signal (β-globin polyA) Simian virus 40 polyadenylation signal (SV40 polyA) |
Selection marker: | Ampicillin (amp) |
Replicon: | Escherichia coli plasmid pMB1 origin Simian virus 40 bidirectional origin (SV40) |
Host range: | Escherichia coli Mammalian cells; SV40 permissive cells |
Parental clone: | pCAGGS |
Further information: | The plasmid was constructed as follows: 1) the hUNR cDNA was amplified by PCR; 2) the NotI/XhoI digested PCR amplicon was fused to the E-tag of a NotI/XhoI opened pCAGGS-based expression plasmid. pCAGGS-E-hUNR is useful for highly efficient expression of hUNR under the control of the AG promoter and the hCMV-IE enhancer in various mammalian cells. When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide. The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT726829.1. The nucleotide sequence of the hUNR cDNA corresponds with the Genbank accession number NM_001007553.1 which was adapted according to the reverse primer J described in Schepens et al. (2007). Other name of the plasmid is pcUNR. |
EMBL Accession number: | NM_001007553.1, view at GenBank LT726829.1, view at EMBL, GenBank, DDBJ |
Latest sequence update: | 15/01/2007 |
Sequence detail: | The primers used in PCR to amplify hUNR cDNA were: forward: 5' ATAAGAATGCGGCCGCTATGAGCTTTGATC 3' Primer I * NotI reverse: 5' AACCGCTCGAGTTAATCAATGACACCAGCTTGACGGATCTT 3' Primer J * XhoI | G according to NM_001007553 (results in same amino acid (Asp)) *: Schepens et al., EMBO J. 26 (2007), 158-169 |
Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: Alw44I/HincII, AlwNI, CaiI, EcoRI, NotI and NotI/XhoI. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | This plasmid was deposited by Dr B. Schepens(1) (2) and Prof. Dr R. Beyaert(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
Plasmid reference: | Schepens et al., EMBO J. 26 (2007), 158-169 [PMID: 17159903] |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 MC1061 |
Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
Cultivation temperature: | 37°C |
Biosafety level: | L1 |
Cultivation remark: | - |
Other culture collection numbers: | LMBP 05212 |
Refer in your Materials and Methods: |
pCAGGS-E-hUNR (LMBP 6421) is available at BCCM/GeneCorner. This plasmid was deposited by Dr B. Schepens and Prof. Dr R. Beyaert and was published in Schepens et al., 2007. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.