GeneCorner plasmid details

Last data update: 11 May 2021 08:47 CEST

Plasmid name: pCAGGS-E-mABIN-2d3 (LMBP 4379)

Add to cart

New search Print data sheet
Price category: Cat. 1 (cf. price list)
Status: GeneCorner non-core plasmid
Depositor's sequence:
analysis results


Cloned DNA: Mouse A20-binding inhibitor of NF-κB activation 2 cDNA (ABIN-2, TNIP2); with internal deletion
E-tag; N-terminal
Promoter: Chicken β-actin/rabbit β-globin hybrid promoter (AG)
Human cytomegalovirus immediate early promoter (CMV-IE); enhancer only
Escherichia coli lac operon promoter
binding site:
Terminator: Rabbit β-globin polyadenylation signal (β-globin polyA)
Simian virus 40 polyadenylation signal (SV40 polyA)
Selection marker: Ampicillin (amp)
Replicon: Escherichia coli plasmid pMB1 origin
Simian virus 40 bidirectional origin (SV40)
Host range: Escherichia coli
Mammalian cells; SV40 permissive cells
Parental clone: pCAGGS-E-mABIN-2
Further information: The plasmid was constructed by inserting a NotI-BglII fragment of the mouse A20-binding inhibitor of NF-κB activation 2 cDNA (mABIN-2), with codons 256-320 deleted, into the NotI-BglII opened pCAGGS-E-mABIN-2 vector.
pCAGGS-E-mABIN-2d3 is useful for highly efficient expression of partial mABIN-2 under the control of the chicken β-actin/rabbit β-globin hybrid promoter (AG) and the human CMV-IE enhancer in various mammalian cells.
The AG promoter sequence consists of the chicken β-actin promoter, the first exon and part of the first intron (that seems to have a strong enhancer-like activity) linked to a rabbit β-globin fragment, consisting of a 3' part of the second intron (inclusive a branch point which is required for normal splicing reactions) and a 5' part of the third exon.
When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide.
The nucleotide sequence of the mABIN-2 cDNA corresponds with the EMBL Nucleotide Sequence Database accession number AJ304865.1.
Other name of the plasmid is pCAGGS-E-mABIN-2(Δ256-320).
EMBL Accession number: AJ304865.1, view at EMBL, GenBank, DDBJ
Latest sequence update: 26/06/2001
Sequence detail:
fusion PCR was used on the pCAGGS-E-mABIN-2 vector to generate the insert :

               Reverse: 5' TACTGTGCGCAGGCTCCAGAGGGACCTG 3'

Authenticity test: The plasmid still needs to be subjected to the authenticity test.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by S. Van Huffel(1) (2) and Prof. Dr R. Beyaert(1) (2).
(1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium
(2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium
Plasmid reference: Van Huffel et al., J. Biol. Chem. 276 (2001), 30216-30223 [PMID: 11390377]
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 DH5α
Host reference: Focus 8 (1986), 9
Related host reference: Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660]
Rodriguez-Quinones et al., Focus 15 (1993), 110-112
Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791]
Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187]
Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051]
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Cultivation remark: -
Other culture collection numbers: -

Refer in your Materials and Methods:

pCAGGS-E-mABIN-2d3 (LMBP 4379) is available at BCCM/GeneCorner. This plasmid was deposited by S. Van Huffel and Prof. Dr R. Beyaert and was published in Van Huffel et al., 2001.

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search