Last data update: 18 January 2021 04:24 CET
Plasmid name: pSV23SE6H (LMBP 1683)
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner core plasmid |
GeneCorner sequence: |
p1683.gb
(View with Genome Compiler) p1683.pdf |
Sequence analysis results Genecorner: |
- |
Cloned DNA: |
Mouse anti-hPLAP monoclonal antibody E6(IgG2b,κ) cDNA; heavy chain (E6H) |
Promoter: | Simian virus 40 early promoter (SV40 early) |
Ribosome binding site: |
- |
Terminator: | Simian virus 40 polyadenylation signal (SV40 polyA) |
Selection marker: | Ampicillin (amp) |
Replicon: | Escherichia coli plasmid pMB1 origin Simian virus 40 bidirectional origin (SV40) |
Host range: | Escherichia coli Mammalian cells; SV40 permissive cells |
Parental clone: | pSV23S; pBRE6H |
Further information: | The NcoI-KpnI fragment of pBRE6H, containing the cDNA copy of the heavy chain E6H of the mouse monoclonal antibody E6(IgG2b,κ), was blunted (NcoI filled in with Klenow DNA polymerase and KpnI blunted with T4 DNA polymerase) and inserted into the filled- in (with Klenow DNA polymerase) XbaI site of pSV23S. pSV23SE6H was designed for transient expression in COS cells or constitutive expression in CHO cells (cotransfection with DHFR plasmids). The E6H cDNA is under control of the SV40 early promoter. Name of he plasmid mentioned in Feys et al. (1988) is pSV23PE6H. The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727584.1. |
EMBL Accession number: | LT727584.1, view at EMBL, GenBank, DDBJ |
Latest sequence update: | 22/03/1989 |
Sequence detail: | Nucleotide sequence in front of the start codon of E6H: Filled-in NcoI ----- 5' AAGCTTGGCTCTAGCATGGAA 3' HindIII ----- * Filled-in XbaI *: Start codon of E6H, located in the blunted NcoI site. |
Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: BamHI/HindIII, BglI/XmnI, ClaI/RsaI, EcoRI, KpnI/SacI, NcoI/XbaI, SalI and TaqI. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | This plasmid was deposited by P. De Waele(1) and Prof. Dr W. Fiers(1). (1) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
Plasmid reference: | De Waele et al., Eur. J. Biochem. 176 (1988), 287-295 [PMID: 3138116] |
Related plasmid reference: | Feys et al., Int. J. Cancer Suppl. 2 (1988), 26-27 [PMID: 3162443] |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 MC1061 |
Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
Cultivation temperature: | 37°C |
Biosafety level: | L1 |
Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pSV23SE6H (LMBP 1683) is available at BCCM/GeneCorner. This plasmid was deposited by P. De Waele and Prof. Dr W. Fiers and was published in De Waele et al., 1988. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.